or
or
Exact

Results for "Iossifov2012"

Variant Events: 444

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SCN2A     13642.p1chr2:
166234111-166234111
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C4259T
c.C4259T
c.C4259T
p.T1420M
p.T1420M
p.T1420M
28.0-Iossifov2012 E
TRIM17     13586.p1chr1:
228596935-228596935
GGGexonicDe novoframeshift insertionNM_001024940
NM_001134855
NM_016102
c.820dupC
c.820dupC
c.820dupC
p.P274fs
p.P274fs
p.P274fs
--Iossifov2012 E
ARHGAP30     13628.p1chr1:
161023097-161023100
CTCCCexonicDe novononframeshift deletionNM_001287602
NM_001287600
NM_001025598
NM_181720
c.81_83del
c.168_170del
c.612_614del
c.612_614del
p.27_28del
p.56_57del
p.204_205del
p.204_205del
--Iossifov2012 E
C8orf31     13012.p1chr8:
144126056-144126057
CCCintronicDe novo--Iossifov2012 E
PCDHA13     12773.p1chr5:
140263887-140263891
TTCGTTexonicDe novoframeshift deletionNM_018904
NM_031865
c.2035_2038del
c.2035_2038del
p.S679fs
p.S679fs
--Iossifov2012 E
PCOLCE     13018.p1chr7:
100201680-100201681
TGTexonicDe novoframeshift deletionNM_002593c.304delGp.G102fs--Iossifov2012 E
PARP6     13038.p1chr15:
72535064-72535069
TTCATTTintronicDe novo--Iossifov2012 E
KDM6B     12683.p1chr17:
7749922-7749923
GGGexonicDe novoframeshift deletionNM_001080424c.576delGp.R192fs--Iossifov2012 E
TROVE2     12826.p1chr1:
193045126-193045130
TTAGTTexonicDe novoframeshift deletionNM_001042369
NM_001042370
NM_001173524
NM_001173525
NM_004600
c.758_761del
c.758_761del
c.758_761del
c.758_761del
c.758_761del
p.L253fs
p.L253fs
p.L253fs
p.L253fs
p.L253fs
--Iossifov2012 E
DLL1     12653.p1chr6:
170593076-170593076
AAAexonicDe novoframeshift insertionNM_005618c.1291dupTp.C431fs--Iossifov2012 E
POGZ     13398.p1chr1:
151377904-151377904
CCCGTCATCAexonicDe novostopgainNM_145796
NM_207171
NM_001194938
NM_001194937
NM_015100
c.3321_3322insTGATGACG
c.3447_3448insTGATGACG
c.3420_3421insTGATGACG
c.3579_3580insTGATGACG
c.3606_3607insTGATGACG
p.E1108_I1109delinsX
p.E1150_I1151delinsX
p.E1141_I1142delinsX
p.E1194_I1195delinsX
p.E1203_I1204delinsX
--Iossifov2012 E
GIMAP8     13096.p1chr7:
150164232-150164233
AAAexonicDe novoframeshift deletionNM_175571c.447delAp.E149fs--Iossifov2012 E
BUB3     13187.p1chr10:
124923292-124923293
CCCintronicDe novo--Iossifov2012 E
MFRP     13168.p1chr11:
119214625-119214626
TGTexonicDe novoframeshift deletionNM_031433c.1024delCp.Q342fs--Iossifov2012 E
CTTNBP2     13070.p1chr7:
117423008-117423010
CACCexonicDe novoframeshift deletionNM_033427c.2278_2279delp.V760fs--Iossifov2012 E
ACACB     13585.p1chr12:
109577550-109577550
GGGexonicDe novoframeshift insertionNM_001093c.340dupGp.E114fs--Iossifov2012 E
PHF2     12323.p1chr9:
96439930-96439931
TTTexonicDe novoframeshift deletionNM_005392c.3264delTp.I1088fs--Iossifov2012 E
GRM5     12529.p1chr11:
88300813-88300816
TCTTTexonicDe novononframeshift deletionNM_001143831
NM_000842
c.2035_2037del
c.2035_2037del
p.679_679del
p.679_679del
--Iossifov2012 E
MTHFS     13590.p1chr15:
80137554-80137554
AAAexonicDe novostoplossNM_001199758
NM_006441
NM_001199760
c.438dupT
c.609dupT
c.537dupT
p.X147delinsL
p.X204delinsL
p.X180delinsL
--Iossifov2012 E
RIMS1     13162.p1chr6:
72889392-72889392
AAAexonicDe novoframeshift insertionNM_014989c.586dupAp.T196fs--Iossifov2012 E
ZFYVE26     13176.p1chr14:
68272015-68272016
CCCexonicDe novoframeshift deletionNM_015346c.1189delGp.G397fs--Iossifov2012 E
DST     13612.p1chr6:
56393644-56393648
GTTTGGexonicDe novoframeshift deletionNM_015548
NM_183380
NM_001144770
NM_001144769
c.9802_9805del
c.10780_10783del
c.10900_10903del
c.11314_11317del
p.Q3268fs
p.Q3594fs
p.Q3634fs
p.Q3772fs
--Iossifov2012 E
CSTF2T     13439.p1chr10:
53458250-53458250
AAAexonicDe novoframeshift insertionNM_015235c.1059dupTp.Y354fs--Iossifov2012 E
LMTK3     13092.p1chr19:
49004781-49004781
AAAGGTCAGexonicDe novoframeshift insertionNM_001080434c.919_920insCTGACCTp.L307fs--Iossifov2012 E
DIP2A     13012.p1chr21:
47958430-47958430
CCCTGGTCTexonicDe novoframeshift insertionNM_001146115
NM_001146116
NM_015151
NM_206889
NM_206890
NM_206891
c.1707_1708insCTGGTCT
c.1824_1825insCTGGTCT
c.1836_1837insCTGGTCT
c.1836_1837insCTGGTCT
c.1836_1837insCTGGTCT
c.1836_1837insCTGGTCT
p.H569fs
p.H608fs
p.H612fs
p.H612fs
p.H612fs
p.H612fs
--Iossifov2012 E
ATP10D     13616.p1chr4:
47571001-47571001
GGGexonicDe novoframeshift insertionNM_020453c.3001dupGp.G1001fs--Iossifov2012 E
SLC25A39     12939.p1chr17:
42399124-42399126
CACCexonicDe novoframeshift deletionNM_001143780
NM_016016
c.334_335del
c.310_311del
p.V112fs
p.V104fs
--Iossifov2012 E
PLCG1     13515.p1chr20:
39791806-39791806
TTTintronicDe novo--Iossifov2012 E
DYRK1A     13552.p1chr21:
38877834-38877835
CCCexonicDe novoframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
c.1489delC
c.1462delC
c.1489delC
c.1489delC
p.P497fs
p.P488fs
p.P497fs
p.P497fs
--Iossifov2012 E
PAX5     12858.p1chr9:
37015071-37015072
GGGexonicDe novoframeshift deletionNM_001280551
NM_001280556
NM_001280547
NM_001280548
NM_001280549
NM_001280550
NM_001280552
NM_001280553
NM_001280554
NM_016734
c.8delC
c.8delC
c.332delC
c.332delC
c.332delC
c.332delC
c.332delC
c.332delC
c.332delC
c.332delC
p.A3fs
p.A3fs
p.A111fs
p.A111fs
p.A111fs
p.A111fs
p.A111fs
p.A111fs
p.A111fs
p.A111fs
--Iossifov2012 E
VCP     13646.p1chr9:
35060456-35060461
AGAACAAexonicDe novoframeshift deletionNM_007126c.1544_1548delp.L515fs--Iossifov2012 E
HECTD1     12787.p1chr14:
31641108-31641111
ATGAAexonicDe novononframeshift deletionNM_015382c.1288_1290delp.430_430del--Iossifov2012 E
SPATA13         12652.p1chr13:
24797448-24797449
CCCexonicDe novoframeshift deletionNM_001166271
NM_001286792
c.382delC
c.568delC
p.R128fs
p.R190fs
--Iossifov2012 E
PRMT5-AS1     13307.p1chr14:
23392076-23392077
GGGncRNA_intronicDe novo--Iossifov2012 E
BRD4     12733.p1chr19:
15376363-15376366
AGGAAexonicDe novononframeshift deletionNM_014299
NM_058243
c.648_650del
c.648_650del
p.216_217del
p.216_217del
--Iossifov2012 E
GALNT18     13548.p1chr11:
11314690-11314691
GGGexonicDe novoframeshift deletionNM_198516c.1562delCp.P521fs--Iossifov2012 E
DIP2C     12705.p1chr10:
428609-428609
CCCexonicDe novoframeshift insertionNM_014974c.1968dupGp.A657fs--Iossifov2012 E
BCL11A     13183.p1chr2:
60689254-60689254
GGGexonicDe novoframeshift insertionNM_018014
NM_022893
c.792dupC
c.792dupC
p.L265fs
p.L265fs
--Iossifov2012 E
ATP12A     13578.p1chr13:
25280526-25280532
CAACTACCexonicDe novononframeshift deletionNM_001185085
NM_001676
c.2113_2118del
c.2095_2100del
p.705_706del
p.699_700del
--Iossifov2012 E
DPYSL4     13302.p1chr10:
134010619-134010642
GGGCTGCCGTGGGGCAGGCACAGGGintronicDe novo--Iossifov2012 E
EFCAB5     13590.p1chr17:
28400679-28400680
TTTexonicDe novoframeshift deletionNM_001145053c.2543delTp.F848fs--Iossifov2012 E
ENSA     12438.p1chr1:
150601998-150601999
GGGUTR5De novo--Iossifov2012 E
FLG     13471.p1chr1:
152286920-152286922
CTGCexonicDe novoframeshift deletionNM_002016c.440_441delp.T147fs--Iossifov2012 E
GDPD4     12952.p1chr11:
76928312-76928312
AAATCTUTR3De novo--Iossifov2012 E
GNPTG     12252.p1chr16:
1412556-1412589
GCCCCTGGTGGGCCTGGCTGGGAGCTGGGTGCTGGintronicDe novo--Iossifov2012 E
MED13L     12969.p1chr12:
116418554-116418554
CCCsplicingDe novosplicing--Iossifov2012 E
KMT2E     12952.p1chr7:
104748101-104748102
CCCexonicDe novoframeshift deletionNM_018682
NM_182931
c.3198delC
c.3198delC
p.S1066fs
p.S1066fs
--Iossifov2012 E
NOP56     12787.p1chr20:
2637204-2637204
GGGintronicDe novo--Iossifov2012 E
OTUD7A     12628.p1chr15:
31776796-31776805
CTTGCCGTTCCexonicDe novononframeshift deletionNM_130901c.1473_1481delp.491_494del--Iossifov2012 E
PLXNB2     12894.p1chr22:
50721196-50721199
GAAGGexonicDe novononframeshift deletionNM_012401c.2928_2930delp.976_977del--Iossifov2012 E
RGPD4     13646.p1chr2:
108499346-108499348
TCTTintronicDe novo--Iossifov2012 E
TUBGCP4     13537.p1chr15:
43694049-43694053
GTAAGGsplicingDe novosplicing--Iossifov2012 E
UBN2     12950.p1chr7:
138968840-138968844
CTCTCCexonicDe novoframeshift deletionNM_173569c.3190_3193delp.S1064fs--Iossifov2012 E
ZNF175     12937.p1chr19:
52085150-52085151
CCCintronicDe novo--Iossifov2012 E
ZWILCH     12859.p1chr15:
66813381-66813383
TTTTintronicDe novo--Iossifov2012 E
SND1     11078.p1chr7:
127631105-127631105
GAexonicDe novononsynonymous SNVNM_014390c.G1775Ap.R592Q35.02.806E-5Iossifov2012 E
COLEC12     11078.p1chr18:
321720-321720
CAexonicDe novononsynonymous SNVNM_130386c.G2151Tp.W717C19.89-Iossifov2012 E
SV2C     11078.p1chr5:
75469979-75469979
GTintronicDe novo--Iossifov2012 E
C9orf78     11078.p1chr9:
132591824-132591824
TCintronicDe novo-8.348E-6Iossifov2012 E
POLR3D     11818.p1chr8:
22108171-22108171
CGUTR3De novo--Iossifov2012 E
KRBA1     11818.p1chr7:
149419954-149419954
GAexonicDe novounknown15.173.338E-5Iossifov2012 E
PM20D1     12055.p1chr1:
205797834-205797834
AGexonicDe novononsynonymous SNVNM_152491c.T1423Cp.Y475H14.02-Iossifov2012 E
ITGA3     12055.p1chr17:
48145447-48145447
CTexonicDe novosynonymous SNVNM_002204c.C442Tp.L148L--Iossifov2012 E
ZNF860     12055.p1chr3:
32030783-32030783
TCexonicDe novononsynonymous SNVNM_001137674c.T212Cp.M71T0.856-Iossifov2012 E
PLD5     12055.p1chr1:
242383342-242383342
TCexonicDe novononsynonymous SNVNM_001195812
NM_001195811
NM_152666
c.A59G
c.A497G
c.A683G
p.K20R
p.K166R
p.K228R
11.14-Iossifov2012 E
BEST3     12076.p1chr12:
70087547-70087547
GTexonicDe novononsynonymous SNVNM_001282613
NM_001282615
NM_001282616
NM_001282614
NM_032735
c.C70A
c.C70A
c.C70A
c.C388A
c.C388A
p.R24S
p.R24S
p.R24S
p.R130S
p.R130S
23.2-Iossifov2012 E
NCKAP1     12764.p1chr2:
183791570-183791570
CAexonicDe novostopgainNM_013436
NM_205842
c.G3244T
c.G3262T
p.E1082X
p.E1088X
48.0-Iossifov2012 E
CFAP74     12221.p1chr1:
1886352-1886352
CTintronicDe novo--Iossifov2012 E
EPHX2     12243.p1chr8:
27362614-27362614
CTexonicDe novononsynonymous SNVNM_001256483
NM_001256482
NM_001256484
NM_001979
c.C290T
c.C329T
c.C329T
c.C488T
p.P97L
p.P110L
p.P110L
p.P163L
12.92-Iossifov2012 E
ADGRF3     12252.p1chr2:
26536713-26536713
CTexonicDe novosynonymous SNVNM_153835
NM_001145169
NM_001145168
c.G594A
c.G984A
c.G1191A
p.P198P
p.P328P
p.P397P
-8.256E-6Iossifov2012 E
PIK3R2       12252.p1chr19:
18273859-18273859
GAexonicDe novononsynonymous SNVNM_005027c.G1192Ap.V398I17.914.132E-5Iossifov2012 E
ACTN4     12252.p1chr19:
39214685-39214685
AGexonicDe novononsynonymous SNVNM_004924c.A1660Gp.M554V10.52-Iossifov2012 E
LOC654841    12313.p1chr2:
228112254-228112254
AGncRNA_intronicDe novo--Iossifov2012 E
ARHGEF33     12321.p1chr2:
39148582-39148582
GTintronicDe novo--Iossifov2012 E
TTN     12323.p1chr2:
179447820-179447820
GTexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.C38515A
c.C38890A
c.C39091A
c.C58006A
c.C60787A
c.C65710A
p.L12839I
p.L12964I
p.L13031I
p.L19336I
p.L20263I
p.L21904I
13.75-Iossifov2012 E
PAFAH1B2     12438.p1chr11:
117034592-117034592
CGsplicing;exonicDe novononsynonymous SNVNM_001309431
NM_001184746
NM_001184747
NM_002572
c.C251G
c.C395G
c.C395G
c.C395G
p.A84G
p.A132G
p.A132G
p.A132G
27.6-Iossifov2012 E
DRAM2     12360.p1chr1:
111663323-111663323
AGintronicDe novo--Iossifov2012 E
MPO     12360.p1chr17:
56356401-56356401
ACexonicDe novononsynonymous SNVNM_000250c.T853Gp.C285G25.2-Iossifov2012 E
EXOC6     12363.p1chr10:
94659341-94659341
TCintronicDe novo-8.578E-6Iossifov2012 E
CAPS     12394.p1chr19:
5915243-5915243
GAexonicDe novosynonymous SNVNM_004058
NM_080590
c.G738A
c.G657A
p.A246A
p.A219A
-2.511E-5Iossifov2012 E
TRPV5     12396.p1chr7:
142609791-142609791
CTexonicDe novononsynonymous SNVNM_019841c.G1645Ap.V549M14.742.471E-5Iossifov2012 E
KMT5B     12864.p1chr11:
67938481-67938481
CTsplicingDe novosplicing16.07-Iossifov2012 E
HRH2     12420.p1chr5:
175110636-175110636
CTexonicDe novononsynonymous SNVNM_022304
NM_001131055
c.C400T
c.C400T
p.R134W
p.R134W
17.52-Iossifov2012 E
GOLGA4     12420.p1chr3:
37369172-37369172
TCexonicDe novononsynonymous SNVNM_002078
NM_001172713
c.T5795C
c.T5861C
p.L1932S
p.L1954S
15.83-Iossifov2012 E
TRIM6     12493.p1chr11:
5632063-5632063
CTexonicDe novononsynonymous SNVNM_001198645
NM_001198644
NM_001003818
NM_058166
c.C433T
c.C433T
c.C1042T
c.C958T
p.R145W
p.R145W
p.R348W
p.R320W
12.78.237E-6Iossifov2012 E
ACRBP     12426.p1chr12:
6752713-6752713
CTexonicDe novononsynonymous SNVNM_032489c.G1069Ap.G357R14.6-Iossifov2012 E
SH3TC2     12497.p1chr5:
148422396-148422396
GAexonicDe novosynonymous SNVNM_024577c.C390Tp.Y130Y-4.119E-5Iossifov2012 E
ERMAP     12498.p1chr1:
43305911-43305911
CTintronicDe novo--Iossifov2012 E
ZNF214     12449.p1chr11:
7021423-7021423
GAexonicDe novosynonymous SNVNM_013249c.C1491Tp.P497P--Iossifov2012 E
HSPA4     12449.p1chr5:
132403139-132403139
GAexonicDe novononsynonymous SNVNM_002154c.G196Ap.G66R28.3-Iossifov2012 E
FREM3     12449.p1chr4:
144619732-144619732
AGexonicDe novosynonymous SNVNM_001168235c.T2097Cp.D699D--Iossifov2012 E
CNPY2     12462.p1chr12:
56704761-56704761
TGexonicDe novononsynonymous SNVNM_014255c.A486Cp.K162N15.03-Iossifov2012 E
HIST1H4E     12462.p1chr6:
26204935-26204935
GAexonicDe novosynonymous SNVNM_003545c.G63Ap.K21K-2.472E-5Iossifov2012 E
KIRREL2     12462.p1chr19:
36350434-36350434
ATexonicDe novononsynonymous SNVNM_199179
NM_032123
NM_199180
c.A424T
c.A574T
c.A574T
p.T142S
p.T192S
p.T192S
10.2-Iossifov2012 E
HNRNPUL1     12462.p1chr19:
41800478-41800478
CTexonicDe novononsynonymous SNVNM_001301016
NM_007040
NM_144732
c.C1138T
c.C1405T
c.C1105T
p.R380W
p.R469W
p.R369W
22.7-Iossifov2012 E
TRIP12     12867.p1chr2:
230701696-230701696
GAexonicDe novostopgainNM_001284216
NM_001284215
NM_004238
NM_001284214
c.C103T
c.C1012T
c.C1012T
c.C1138T
p.R35X
p.R338X
p.R338X
p.R380X
38.0-Iossifov2012 E
LRMP     12463.p1chr12:
25257411-25257411
GCintronicDe novo--Iossifov2012 E
GCN1     12467.p1chr12:
120575778-120575778
CTexonicDe novononsynonymous SNVNM_006836c.G6320Ap.R2107H21.74.0E-4Iossifov2012 E
CPA4     12498.p1chr7:
129938587-129938587
GTexonicDe novononsynonymous SNVNM_001163446
NM_016352
c.G70T
c.G70T
p.D24Y
p.D24Y
17.8-Iossifov2012 E
MYO9B     12501.p1chr19:
17318044-17318044
AGexonicDe novononsynonymous SNVNM_001130065
NM_004145
c.A5615G
c.A5615G
p.K1872R
p.K1872R
15.78-Iossifov2012 E
CATSPER3     12497.p1chr5:
134346043-134346043
CTintronicDe novo-8.243E-5Iossifov2012 E
WDFY4     12497.p1chr10:
49982706-49982706
GAexonicDe novosynonymous SNVNM_020945c.G2757Ap.P919P0.385-Iossifov2012 E
NFIA     13670.p1chr1:
61553905-61553905
CTexonicDe novostopgainNM_001134673
NM_001145511
NM_005595
NM_001145512
c.C112T
c.C88T
c.C112T
c.C247T
p.R38X
p.R30X
p.R38X
p.R83X
40.0-Iossifov2012 E
DCAF11     12501.p1chr14:
24589008-24589008
GAexonicDe novononsynonymous SNVNM_001163484
NM_025230
NM_181357
c.G995A
c.G995A
c.G917A
p.C332Y
p.C332Y
p.C306Y
29.5-Iossifov2012 E
GALNT9     12626.p1chr12:
132688118-132688118
GAexonicDe novononsynonymous SNVNM_021808
NM_001122636
c.C97T
c.C1195T
p.R33C
p.R399C
17.941.664E-5Iossifov2012 E
PTPRN2     12510.p1chr7:
158109533-158109533
CTexonicDe novosynonymous SNVNM_130842
NM_001308268
NM_002847
NM_130843
c.G204A
c.G324A
c.G255A
c.G255A
p.A68A
p.A108A
p.A85A
p.A85A
-7.118E-5Iossifov2012 E
CLCN7     12515.p1chr16:
1510886-1510886
GTexonicDe novononsynonymous SNVNM_001114331
NM_001287
c.C343A
c.C415A
p.L115I
p.L139I
24.3-Iossifov2012 E
G3BP2     12523.p1chr4:
76580350-76580350
AGexonicDe novononsynonymous SNVNM_012297
NM_203504
NM_203505
c.T626C
c.T626C
c.T626C
p.L209P
p.L209P
p.L209P
10.36-Iossifov2012 E
PLEKHA8     12523.p1chr7:
30101537-30101537
AGexonicDe novononsynonymous SNVNM_001197026
NM_001197027
NM_032639
c.A1123G
c.A1123G
c.A1123G
p.N375D
p.N375D
p.N375D
7.626-Iossifov2012 E
EP400     12548.p1chr12:
132516666-132516666
GAexonicDe novononsynonymous SNVNM_015409c.G5923Ap.G1975R14.27-Iossifov2012 E
ADGRB3     12550.p1chr6:
70034815-70034815
TAexonicDe novononsynonymous SNVNM_001704c.T2866Ap.F956I35.0-Iossifov2012 E
BTBD11     12550.p1chr12:
108035955-108035955
CTintronicDe novo--Iossifov2012 E
ADNP2     12550.p1chr18:
77895204-77895204
GAexonicDe novosynonymous SNVNM_014913c.G1908Ap.P636P-0.001Iossifov2012 E
ZNF337     12550.p1chr20:
25656070-25656070
GAexonicDe novosynonymous SNVNM_001290261
NM_015655
c.C1854T
c.C1854T
p.H618H
p.H618H
--Iossifov2012 E
SNX5     12563.p1chr20:
17928186-17928186
GAexonicDe novononsynonymous SNVNM_001282454
NM_014426
NM_152227
c.C707T
c.C1022T
c.C1022T
p.A236V
p.A341V
p.A341V
14.59-Iossifov2012 E
GABRB3     12573.p1chr15:
26828534-26828534
CTexonicDe novononsynonymous SNVNM_001191320
NM_001191321
NM_000814
NM_021912
NM_001278631
c.G234A
c.G276A
c.G489A
c.G489A
c.G234A
p.M78I
p.M92I
p.M163I
p.M163I
p.M78I
17.36-Iossifov2012 E
TMEM41A     12573.p1chr3:
185209431-185209431
AGexonicDe novononsynonymous SNVNM_080652c.T689Cp.M230T15.01-Iossifov2012 E
ELOVL1     12579.p1chr1:
43830302-43830302
CTexonicDe novononsynonymous SNVNM_001256401
NM_001256402
NM_001256399
NM_022821
c.G311A
c.G149A
c.G392A
c.G392A
p.R104Q
p.R50Q
p.R131Q
p.R131Q
25.3-Iossifov2012 E
CFAP46     12579.p1chr10:
134743800-134743800
AGintronicDe novo--Iossifov2012 E
COL26A1     12582.p1chr7:
101091005-101091005
CTexonicDe novounknown20.7-Iossifov2012 E
SLC26A6     12588.p1chr3:
48670523-48670523
GAintronicDe novo11.48-Iossifov2012 E
ARFGEF3     12735.p1chr6:
138615277-138615277
TCintronicDe novo--Iossifov2012 E
PPRC1     12605.p1chr10:
103908608-103908608
CTexonicDe novononsynonymous SNVNM_001288727
NM_001288728
NM_015062
c.C3860T
c.C4286T
c.C4652T
p.P1287L
p.P1429L
p.P1551L
19.5-Iossifov2012 E
LAMB3     12605.p1chr1:
209823359-209823359
ACexonicDe novononsynonymous SNVNM_001017402
NM_000228
NM_001127641
c.T133G
c.T133G
c.T133G
p.S45A
p.S45A
p.S45A
22.7-Iossifov2012 E
DGKG     12605.p1chr3:
185993461-185993461
GTintronicDe novo--Iossifov2012 E
NEK4     12618.p1chr3:
52771641-52771641
CTexonicDe novosynonymous SNVNM_001193533
NM_003157
c.G2127A
c.G2394A
p.V709V
p.V798V
--Iossifov2012 E
CACNA1D     12620.p1chr3:
53707152-53707152
GAexonicDe novononsynonymous SNVNM_001128839
NM_001128840
c.G1219A
c.G1219A
p.G407R
p.G407R
20.8-Iossifov2012 E
ADAMTSL1     12620.p1chr9:
18622342-18622342
TCexonicDe novosynonymous SNVNM_001040272
NM_052866
c.T576C
c.T576C
p.Y192Y
p.Y192Y
--Iossifov2012 E
AGAP2     12624.p1chr12:
58129165-58129165
GAexonicDe novononsynonymous SNVNM_001122772
NM_014770
c.C1214T
c.C206T
p.P405L
p.P69L
18.69-Iossifov2012 E
AGAP2     12624.p1chr12:
58131129-58131129
GCexonicDe novononsynonymous SNVNM_001122772c.C901Gp.P301A3.738-Iossifov2012 E
POLN     12626.p1chr4:
2129967-2129967
GAintronicDe novo--Iossifov2012 E
FCGBP     12759.p1chr19:
40408653-40408653
CTexonicDe novononsynonymous SNVNM_003890c.G4186Ap.D1396N7.9742.471E-5Iossifov2012 E
TNNI3     12631.p1chr19:
55668031-55668031
GAintronicDe novo--Iossifov2012 E
RHOT2     12637.p1chr16:
719572-719572
TCexonicDe novononsynonymous SNVNM_138769c.T242Cp.V81A15.85-Iossifov2012 E
RNPEPL1     12637.p1chr2:
241517061-241517061
GAexonicDe novononsynonymous SNVNM_018226c.G1930Ap.G644S29.21.727E-5Iossifov2012 E
SEC24D     12638.p1chr4:
119738546-119738546
GTexonicDe novosynonymous SNVNM_014822c.C270Ap.V90V--Iossifov2012 E
DDB1     12642.p1chr11:
61067685-61067685
CTexonicDe novononsynonymous SNVNM_001923c.G3346Ap.D1116N19.15-Iossifov2012 E
KIRREL3     12644.p1chr11:
126343313-126343313
CTexonicDe novononsynonymous SNVNM_001161707
NM_001301097
NM_032531
c.G482A
c.G482A
c.G482A
p.R161H
p.R161H
p.R161H
24.94.394E-5Iossifov2012 E
FAM91A1     12221.p1chr8:
124787443-124787443
CTexonicDe novostopgainNM_144963c.C214Tp.R72X31.0-Iossifov2012 E
PAOX     12645.p1chr10:
135203136-135203136
GAexonicDe novononsynonymous SNVNM_152911c.G1277Ap.R426H15.681.679E-5Iossifov2012 E
ARHGAP21     12645.p1chr10:
24896811-24896811
AGexonicDe novononsynonymous SNVNM_020824c.T2444Cp.I815T13.0-Iossifov2012 E
LRRC31     12645.p1chr3:
169579555-169579555
TAexonicDe novononsynonymous SNVNM_001277127
NM_001277128
NM_024727
c.A222T
c.A222T
c.A222T
p.K74N
p.K74N
p.K74N
9.167-Iossifov2012 E
SWAP70     12652.p1chr11:
9770711-9770711
ATexonicDe novononsynonymous SNVNM_001297714
NM_015055
c.A1458T
c.A1632T
p.L486F
p.L544F
17.78-Iossifov2012 E
CDC34     12652.p1chr19:
536266-536266
CTexonicDe novosynonymous SNVNM_004359c.C288Tp.I96I-4.061E-5Iossifov2012 E
LRP2     12409.p1chr2:
170042308-170042308
GAexonicDe novostopgainNM_004525c.C9550Tp.R3184X53.0-Iossifov2012 E
ABCA13     12653.p1chr7:
48467428-48467428
GCexonicDe novononsynonymous SNVNM_152701c.G12525Cp.E4175D10.97-Iossifov2012 E
EIF4A1     12655.p1chr17:
7481018-7481018
CTexonicDe novosynonymous SNVNM_001204510
NM_001416
c.C900T
c.C900T
p.S300S
p.S300S
-1.0E-4Iossifov2012 E
EIF4A1     12655.p1chr17:
7481011-7481011
CTexonicDe novononsynonymous SNVNM_001204510
NM_001416
c.C893T
c.C893T
p.T298I
p.T298I
12.38-Iossifov2012 E
FAM177B     12655.p1chr1:
222920400-222920400
GAexonicDe novononsynonymous SNVNM_207468c.G218Ap.R73Q10.522.472E-5Iossifov2012 E
UNC80     12463.p1chr2:
210745771-210745771
CTexonicDe novostopgainNM_032504
NM_182587
c.C4069T
c.C4054T
p.R1357X
p.R1352X
44.0-Iossifov2012 E
SF1     12673.p1chr11:
64532910-64532910
TCexonicDe novononsynonymous SNVNM_201997
NM_201995
c.A1667G
c.A1868G
p.Q556R
p.Q623R
13.82-Iossifov2012 E
MUC17     12676.p1chr7:
100679760-100679760
GAexonicDe novononsynonymous SNVNM_001040105c.G5063Ap.G1688E0.0440.0716Iossifov2012 E
PTPRM     12686.p1chr18:
8143719-8143719
GAexonicDe novononsynonymous SNVNM_001105244
NM_002845
c.G2242A
c.G2242A
p.A748T
p.A748T
35.08.237E-6Iossifov2012 E
ADCY5     12688.p1chr3:
123049782-123049782
CTexonicDe novononsynonymous SNVNM_001199642
NM_183357
c.G550A
c.G1600A
p.A184T
p.A534T
37.0-Iossifov2012 E
PLXNB1     12689.p1chr3:
48457121-48457121
CAexonicDe novononsynonymous SNVNM_001130082
NM_002673
c.G3665T
c.G3665T
p.R1222L
p.R1222L
8.546-Iossifov2012 E
PDE4B     12691.p1chr1:
66833455-66833455
GAexonicDe novosynonymous SNVNM_001037339
NM_001297442
NM_001037340
NM_001297440
NM_001297441
NM_001037341
NM_002600
c.G945A
c.G762A
c.G1416A
c.G1185A
c.G1236A
c.G1461A
c.G1461A
p.L315L
p.L254L
p.L472L
p.L395L
p.L412L
p.L487L
p.L487L
-8.248E-6Iossifov2012 E
FLNC     12697.p1chr7:
128490012-128490012
CTintronicDe novo-4.0E-4Iossifov2012 E
IFITM2     12697.p1chr11:
308354-308354
TCexonicDe novosynonymous SNVNM_006435c.T162Cp.P54P-0.0532Iossifov2012 E
LSS     12704.p1chr21:
47628255-47628255
GAintronicDe novo-0.0011Iossifov2012 E
PNISR     12708.p1chr6:
99848937-99848937
GAexonicDe novononsynonymous SNVNM_015491
NM_032870
c.C1897T
c.C1897T
p.R633C
p.R633C
17.448.242E-6Iossifov2012 E
MAPRE1     12716.p1chr20:
31549114-31549114
CTintergenicDe novo--Iossifov2012 E
TPR     12719.p1chr1:
186305701-186305701
TCexonicDe novosynonymous SNVNM_003292c.A4632Gp.Q1544Q--Iossifov2012 E
APOC4-APOC2   12720.p1chr19:
45445522-45445522
GAncRNA_exonicDe novo-2.0E-4Iossifov2012 E
MROH7     12792.p1chr1:
55167767-55167767
GAexonicDe novononsynonymous SNVNM_001291332
NM_001039464
c.G1844A
c.G3290A
p.R615Q
p.R1097Q
18.329.317E-6Iossifov2012 E
MTMR6     12723.p1chr13:
25823559-25823559
AGexonicDe novosynonymous SNVNM_004685c.T1677Cp.P559P--Iossifov2012 E
MIR589     12723.p1chr7:
5535544-5535544
CGncRNA_exonicDe novo--Iossifov2012 E
GLRA2     12724.p1chrX:
14548195-14548195
GCexonicDe novononsynonymous SNVNM_001118886
NM_002063
NM_001118885
c.G16C
c.G16C
c.G16C
p.V6L
p.V6L
p.V6L
13.54-Iossifov2012 E
ZMAT5     12727.p1chr22:
30144473-30144473
GAexonicDe novononsynonymous SNVNM_001003692
NM_019103
c.C61T
c.C61T
p.R21C
p.R21C
20.98.243E-6Iossifov2012 E
RANBP3     12727.p1chr19:
5957913-5957913
CTintronicDe novo-5.798E-5Iossifov2012 E
PRSS55     12727.p1chr8:
10388838-10388838
CTexonicDe novosynonymous SNVNM_001197020
NM_198464
c.C381T
c.C381T
p.N127N
p.N127N
-9.132E-5Iossifov2012 E
LDLR     12733.p1chr19:
11233938-11233938
CTexonicDe novosynonymous SNVNM_001195800
NM_001195803
NM_001195799
NM_000527
NM_001195798
c.C1725T
c.C1695T
c.C2106T
c.C2229T
c.C2229T
p.T575T
p.T565T
p.T702T
p.T743T
p.T743T
--Iossifov2012 E
CYP4F12     12826.p1chr19:
15791068-15791068
ACexonicDe novononsynonymous SNVNM_023944c.A358Cp.K120Q14.06-Iossifov2012 E
MFSD12     12739.p1chr19:
3546431-3546431
GAintronicDe novo--Iossifov2012 E
PRPF4B     12758.p1chr6:
4049347-4049347
TCintronicDe novo--Iossifov2012 E
RDH8     12864.p1chr19:
10132408-10132408
CTexonicDe novononsynonymous SNVNM_015725c.C979Tp.R327W15.77-Iossifov2012 E
ITPR1     12759.p1chr3:
4699938-4699938
GAexonicDe novononsynonymous SNVNM_001168272
NM_002222
NM_001099952
c.G1082A
c.G1082A
c.G1127A
p.R361H
p.R361H
p.R376H
18.91-Iossifov2012 E
CSPP1     12759.p1chr8:
68074158-68074158
CTintronicDe novo--Iossifov2012 E
DCC     12764.p1chr18:
50848414-50848414
TCintronicDe novo-9.897E-5Iossifov2012 E
NRXN1     12501.p1chr2:
50724605-50724605
ATexonicDe novostopgainNM_004801
NM_001135659
c.T2745A
c.T2865A
p.Y915X
p.Y955X
49.0-Iossifov2012 E
RABL6     12773.p1chr9:
139726740-139726740
GAexonicDe novononsynonymous SNVNM_001173988
NM_001173989
NM_024718
c.G626A
c.G623A
c.G623A
p.R209H
p.R208H
p.R208H
13.138.294E-5Iossifov2012 E
DHX9     12773.p1chr1:
182852665-182852665
GAexonicDe novononsynonymous SNVNM_001357c.G3155Ap.R1052Q33.0-Iossifov2012 E
CAMSAP1     12778.p1chr9:
138774816-138774816
CTexonicDe novononsynonymous SNVNM_015447c.G269Ap.R90H28.3-Iossifov2012 E
RELN     13012.p1chr7:
103180706-103180706
GAexonicDe novononsynonymous SNVNM_005045
NM_173054
c.C6868T
c.C6868T
p.R2290C
p.R2290C
26.3-Iossifov2012 E
MUC5B     12779.p1chr11:
1273699-1273699
CTexonicDe novononsynonymous SNVNM_002458c.C14990Tp.P4997L6.0987.135E-5Iossifov2012 E
MUC2   12782.p1chr11:
1093105-1093105
CGexonicDe novononsynonymous SNVNM_002457c.C4924Gp.P1642A4.06-Iossifov2012 E
PTGES3L     12784.p1chr17:
41122338-41122338
TCexonicDe novononsynonymous SNVNM_001142653
NM_001142654
NM_001136042
NM_001261430
NM_025267
c.A430G
c.A415G
c.A529G
c.A529G
c.A346G
p.K144E
p.K139E
p.K177E
p.K177E
p.K116E
19.22-Iossifov2012 E
SLC47A2     12784.p1chr17:
19584847-19584847
AGintronicDe novo--Iossifov2012 E
PPIP5K2     12785.p1chr5:
102486980-102486980
GCexonicDe novononsynonymous SNVNM_015216
NM_001276277
c.G930C
c.G930C
p.L310F
p.L310F
16.74-Iossifov2012 E
SPANXC     12787.p1chrX:
140785678-140785678
GCexonicDe novononsynonymous SNVNM_022661
NM_032417
c.C238G
c.C238G
p.L80V
p.L80V
0.4020.0162Iossifov2012 E
BIRC6     12792.p1chr2:
32707616-32707616
CTexonicDe novosynonymous SNVNM_016252c.C7662Tp.N2554N--Iossifov2012 E
OR5M9     12792.p1chr11:
56230267-56230267
TCexonicDe novononsynonymous SNVNM_001004743c.A611Gp.N204S6.974-Iossifov2012 E
ANK2     12645.p1chr4:
114232545-114232545
CTexonicDe novostopgainNM_001148
NM_020977
NM_001127493
c.C2683T
c.C2683T
c.C2620T
p.R895X
p.R895X
p.R874X
42.0-Iossifov2012 E
HSD3B1     13120.p1chr1:
120054215-120054215
AGexonicDe novononsynonymous SNVNM_000862c.A235Gp.I79V-0.0482Iossifov2012 E
KCNH3     12792.p1chr12:
49937984-49937984
GAexonicDe novosynonymous SNVNM_001314030
NM_012284
c.G828A
c.G1008A
p.T276T
p.T336T
-0.0056Iossifov2012 E
ADCY6     12794.p1chr12:
49169418-49169418
GCintronicDe novo--Iossifov2012 E
C18orf8     12796.p1chr18:
21104076-21104076
TCintronicDe novo-3.296E-5Iossifov2012 E
CDHR3     12796.p1chr7:
105655655-105655655
TCexonicDe novosynonymous SNVNM_001301161
NM_152750
c.T1059C
c.T1323C
p.Y353Y
p.Y441Y
-1.449E-5Iossifov2012 E
ENPP2     12799.p1chr8:
120580466-120580466
AGexonicDe novononsynonymous SNVNM_001040092
NM_001130863
NM_006209
c.T2080C
c.T2155C
c.T2236C
p.Y694H
p.Y719H
p.Y746H
22.6-Iossifov2012 E
ERP44     12803.p1chr9:
102784415-102784415
CTexonicDe novononsynonymous SNVNM_015051c.G380Ap.R127Q36.0-Iossifov2012 E
KIAA1324     12821.p1chr1:
109742576-109742576
GAexonicDe novononsynonymous SNVNM_001284353
NM_001267048
NM_001284352
NM_020775
c.G1588A
c.G2341A
c.G2296A
c.G2602A
p.V530I
p.V781I
p.V766I
p.V868I
14.132.471E-5Iossifov2012 E
NUP133     12821.p1chr1:
229637765-229637765
GAexonicDe novononsynonymous SNVNM_018230c.C386Tp.A129V15.03-Iossifov2012 E
SLC22A23     12821.p1chr6:
3273379-3273379
CTexonicDe novosynonymous SNVNM_001286455
NM_015482
NM_021945
c.G1128A
c.G1971A
c.G1128A
p.E376E
p.E657E
p.E376E
--Iossifov2012 E
GNS     12826.p1chr12:
65122784-65122784
GAexonicDe novosynonymous SNVNM_002076c.C1152Tp.Y384Y-2.474E-5Iossifov2012 E
ZNF99     13144.p1chr19:
22939456-22939456
TGUTR3De novo0.012-Iossifov2012 E
SMARCC2     12836.p1chr12:
56558283-56558283
CGexonicDe novosynonymous SNVNM_003075c.G3372Cp.P1124P--Iossifov2012 E
TBC1D2B     12836.p1chr15:
78317734-78317734
CGexonicDe novononsynonymous SNVNM_015079
NM_144572
c.G953C
c.G953C
p.G318A
p.G318A
4.539-Iossifov2012 E
AP3D1     13187.p1chr19:
2121195-2121195
TCexonicDe novononsynonymous SNVNM_001261826
NM_003938
c.A1217G
c.A1217G
p.Q406R
p.Q406R
18.02-Iossifov2012 E
SH3RF3     12837.p1chr2:
110259207-110259207
CTexonicDe novononsynonymous SNVNM_001099289c.C2608Tp.R870C18.171.0E-4Iossifov2012 E
ACTL7B     12837.p1chr9:
111617101-111617101
CTexonicDe novosynonymous SNVNM_006686c.G1110Ap.V370V--Iossifov2012 E
EPHA1     12840.p1chr7:
143094667-143094667
CTexonicDe novononsynonymous SNVNM_005232c.G1699Ap.V567I0.0389.911E-5Iossifov2012 E
CIT     12840.p1chr12:
120172026-120172026
TCexonicDe novononsynonymous SNVNM_007174
NM_001206999
c.A3167G
c.A3293G
p.Q1056R
p.Q1098R
13.04-Iossifov2012 E
KIAA0232     12653.p1chr4:
6843914-6843914
CTexonicDe novostopgainNM_001100590
NM_014743
c.C352T
c.C352T
p.R118X
p.R118X
42.0-Iossifov2012 E
RABGGTA     12669.p1chr14:
24737571-24737571
CTintronicDe novo11.17-Iossifov2012 E
UBE3C     12851.p1chr7:
157049644-157049644
TGexonicDe novononsynonymous SNVNM_014671c.T2987Gp.F996C17.4-Iossifov2012 E
RGS2     12851.p1chr1:
192779402-192779402
GAintronicDe novo--Iossifov2012 E
SLC25A29     12851.p1chr14:
100758871-100758871
CTexonicDe novononsynonymous SNVNM_152333
NM_001039355
NM_001291813
NM_001291814
c.G463A
c.G661A
c.G463A
c.G463A
p.G155R
p.G221R
p.G155R
p.G155R
17.84-Iossifov2012 E
APOB     12851.p1chr2:
21229930-21229930
GAexonicDe novosynonymous SNVNM_000384c.C9810Tp.F3270F-1.0E-4Iossifov2012 E
ITGA7     13216.p1chr12:
56079045-56079045
GAexonicDe novononsynonymous SNVNM_001144996
NM_001144997
NM_002206
c.C3223T
c.C2932T
c.C3211T
p.P1075S
p.P978S
p.P1071S
13.56-Iossifov2012 E
HMGXB3     12851.p1chr5:
149390017-149390017
CTexonicDe novononsynonymous SNVNM_014983c.C656Tp.A219V17.36-Iossifov2012 E
DUSP14     12852.p1chr17:
35872627-35872627
CTexonicDe novononsynonymous SNVNM_007026c.C253Tp.P85S5.658-Iossifov2012 E
ADGRV1     12852.p1chr5:
89923398-89923398
ATexonicDe novononsynonymous SNVNM_032119c.A1043Tp.D348V25.5-Iossifov2012 E
ADGRF5     12857.p1chr6:
46826970-46826970
GAexonicDe novosynonymous SNVNM_001098518
NM_015234
c.C2670T
c.C2670T
p.N890N
p.N890N
--Iossifov2012 E
EIF3G     12857.p1chr19:
10226255-10226255
CTexonicDe novononsynonymous SNVNM_003755c.G847Ap.A283T22.1-Iossifov2012 E
FBN1     12858.p1chr15:
48766755-48766755
CTexonicDe novononsynonymous SNVNM_000138c.G4057Ap.G1353R23.2-Iossifov2012 E
DCAF5     12858.p1chr14:
69589039-69589039
GTexonicDe novononsynonymous SNVNM_001284206
NM_001284207
NM_001284208
NM_003861
c.C253A
c.C7A
c.C253A
c.C253A
p.Q85K
p.Q3K
p.Q85K
p.Q85K
13.34-Iossifov2012 E
GALNT17     12859.p1chr7:
71130451-71130451
TCexonicDe novononsynonymous SNVNM_022479c.T1136Cp.I379T26.91.648E-5Iossifov2012 E
SYPL2     12864.p1chr1:
110018244-110018244
CTexonicDe novosynonymous SNVNM_001040709c.C171Tp.S57S-6.628E-5Iossifov2012 E
NR3C2     13197.p1chr4:
149073677-149073677
GTexonicDe novostopgainNM_001166104
NM_000901
c.C2102A
c.C2453A
p.S701X
p.S818X
43.0-Iossifov2012 E
ANO5     12792.p1chr11:
22276997-22276997
CTexonicDe novostopgainNM_001142649
NM_213599
c.C1258T
c.C1261T
p.Q420X
p.Q421X
41.0-Iossifov2012 E
PDLIM1     13234.p1chr10:
96998382-96998382
GAexonicDe novononsynonymous SNVNM_020992c.C746Tp.A249V33.01.65E-5Iossifov2012 E
PLEKHA4     12865.p1chr19:
49341342-49341342
CTexonicDe novononsynonymous SNVNM_020904c.G2009Ap.R670Q15.94-Iossifov2012 E
PPP1R15A     12867.p1chr19:
49376940-49376940
ACexonicDe novosynonymous SNVNM_014330c.A450Cp.T150T--Iossifov2012 E
TRIM23     12867.p1chr5:
64892348-64892348
CTexonicDe novosynonymous SNVNM_001656
NM_033227
NM_033228
c.G1320A
c.G1320A
c.G1320A
p.V440V
p.V440V
p.V440V
--Iossifov2012 E
TM4SF19       12840.p1chr3:
196053904-196053904
CTsplicingDe novosplicing11.38-Iossifov2012 E
IFNA4     12867.p1chr9:
21187406-21187406
GCexonicDe novononsynonymous SNVNM_021068c.C125Gp.A42G2.2981.0E-4Iossifov2012 E
POU3F4