or
or
Exact

Results for "TXNDC2"

Variant Events: 5

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TXNDC2     11027.p1chr18:
9886136-9886136
CTUTR5Mosaic-5.655E-5Dou2017 E
TXNDC2     1-0751-003chr18:
9887930-9887930
CGexonicDe novononsynonymous SNVNM_001098529
NM_032243
c.C1454G
c.C1253G
p.T485S
p.T418S
7.418-Yuen2017 G
TXNDC2     2-0503-004chr18:
9904810-9904810
CAintergenicDe novo--Yuen2017 G
TXNDC2     11407.p1chr18:
9887371-9887371
CAexonicMosaicnonsynonymous SNVNM_001098529
NM_032243
c.C895A
c.C694A
p.L299I
p.L232I
0.3441.665E-5Lim2017 E
TXNDC2     AGG0054chr18:
9886811-9886991
TCCAGCCCAAGGAGGGTGACATCCCCAAGGCCCCAGAAGAAACCATCCAATCCAAGAAGGAGGACCTCCCCAAGTCCTCAGAAAAAGCCATCCAGCCCAAAGAGAGTAACATCCCCAAGTCCTCAGCAAAACCCATCCAGCCCAAGCTGGGCAATATTCCCAAGGCCTCAGTGAAGCCCAGTexonicDe novononframeshift deletionNM_001098529
NM_032243
c.336_515del
c.135_314del
p.112_172del
p.45_105del
--Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More