or
or
Exact

Results for "MUC5B"

Variant Events: 24

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MUC5B     11957.p1chr11:
1270631-1270631
GTexonicDe novononsynonymous SNVNM_002458c.G12521Tp.C4174F10.5-Ji2016 E
Krumm2015 E
MUC5B     12779.p1chr11:
1273699-1273699
CTexonicDe novononsynonymous SNVNM_002458c.C14990Tp.P4997L6.0987.135E-5Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
MUC5B     SSC06612chr11:
1273699-1273699
CTexonicDe novononsynonymous SNVNM_002458c.C14990Tp.P4997L6.0987.135E-5Lim2017 E
MUC5B     12447.p1chr11:
1270260-1270260
CAexonicDe novononsynonymous SNVNM_002458c.C12150Ap.H4050Q3.389-Krumm2015 E
MUC5B     SSC04242chr11:
1270631-1270631
GTexonicDe novononsynonymous SNVNM_002458c.G12521Tp.C4174F10.5-Lim2017 E
MUC5B     EGAN00001100985chr11:
1244474-1244474
TGintronicDe novo-6.0E-4Satterstrom2020 E
MUC5B     AU2433302chr11:
1260171-1260171
ACexonicDe novononsynonymous SNVNM_002458c.A3368Cp.E1123A13.05-Yuen2017 G
MUC5B     08C73088chr11:
1283318-1283318
GAUTR3De novo-2.0E-4Satterstrom2020 E
MUC5B     EGAN00001101030chr11:
1244474-1244474
TGintronicDe novo-6.0E-4Satterstrom2020 E
MUC5B     G01-GEA-262-HIchr11:
1282757-1282757
CTexonicDe novosynonymous SNVNM_002458c.C17208Tp.G5736G--Satterstrom2020 E
MUC5B     12951.p1chr11:
1265906-1265906
CTexonicDe novononsynonymous SNVNM_002458c.C7796Tp.T2599I0.460.0271Iossifov2012 E
MUC5B     13502.p1chr11:
1270407-1270407
GAexonicDe novosynonymous SNVNM_002458c.G12297Ap.T4099T-3.0E-4Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
MUC5B     11078.p1chr11:
1253773-1253773
CAexonicMosaic, De novostopgainNM_002458c.C1937Ap.S646X38.0-Dou2017 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
MUC5B     21742-34594chr11:
1272622-1272624
CTGCexonicframeshift deletionNM_002458c.14513_14514delp.L4838fs--Callaghan2019 G
MUC5B     14183.p1chr11:
1263122-1263122
CTexonicDe novononsynonymous SNVNM_002458c.C5012Tp.T1671M10.44-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Wilfert2021 G
MUC5B     21742-34594chr11:
1272620-1272620
CCTGexonicframeshift insertionNM_002458c.14510_14511insTGp.T4837fs--Callaghan2019 G
MUC5B     11653.p1chr11:
1264158-1264158
TCexonicDe novosynonymous SNVNM_002458c.T6048Cp.T2016T-0.0273Iossifov2014 E
Kosmicki2017 E
MUC5B     11653.p1chr11:
1265831-1265831
TCexonicDe novononsynonymous SNVNM_002458c.T7721Cp.V2574A3.8710.0206Iossifov2014 E
Kosmicki2017 E
MUC5B     11653.p1chr11:
1269758-1269758
CTexonicDe novononsynonymous SNVNM_002458c.C11648Tp.T3883M3.3728.0E-4Iossifov2014 E
Kosmicki2017 E
MUC5B     1-1000-003chr11:
1262965-1262982
GCCACCACCACCACCACCGCCACCACCACCACCexonicDe novononframeshift deletionNM_002458c.4870_4872delp.1624_1624del--Yuen2017 G
MUC5B     13983.p1chr11:
1269769-1269769
CAexonicDe novononsynonymous SNVNM_002458c.C11659Ap.P3887T3.2560.0146Iossifov2014 E
Kosmicki2017 E
MUC5B     2-0323-003chr11:
1249333-1249333
CAintronicDe novo--Yuen2017 G
MUC5B     11653.p1chr11:
1271969-1271984
GCACAACCACCACACCGexonicDe novononframeshift deletionNM_002458c.13860_13874delp.4620_4625del-6.761E-5Iossifov2014 E
Kosmicki2017 E
MUC5B     AU4239301chr11:
1267119-1267119
CTexonicDe novosynonymous SNVNM_002458c.C9009Tp.T3003T-0.0067Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More