or
or
Exact

Results for "BCO1"

Variant Events: 16

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
BCO1     1-0336-003chr16:
81310894-81310894
CTintronicDe novo--Yuen2017 G
BCO1     AU2495302chr16:
81320371-81320371
GAintronicDe novo--Yuen2017 G
BCO1     12083.p1chr16:
81301524-81301524
CAexonicDe novononsynonymous SNVNM_017429c.C631Ap.Q211K0.023-Krumm2015 E
Satterstrom2020 E
BCO1     1-0336-003chr16:
81298538-81298538
CGintronicDe novo--Yuen2017 G
BCO1     12103.p1chr16:
81295822-81295822
CTexonicMosaicsynonymous SNVNM_017429c.C405Tp.F135F--Dou2017 E
Krupp2017 E
BCO1     AU4283301chr16:
81288626-81288626
GAintronicDe novo--Yuen2017 G
BCO1     AU4027306chr16:
81293144-81293144
GAintronicDe novo--Yuen2017 G
BCO1     iHART1378chr16:
81295825-81295825
CAexonicMaternalstopgainNM_017429c.C408Ap.Y136X22.75.766E-5Ruzzo2019 G
BCO1     1-0772-003chr16:
81271958-81271958
CAupstreamDe novo--Yuen2017 G
BCO1     2-0713-003chr16:
81344473-81344473
CTintergenicDe novo--Yuen2017 G
BCO1     AU076705chr16:
81330642-81330642
CGintergenicDe novo--Yuen2017 G
BCO1     5-0021-003chr16:
81323781-81323781
TCintronicDe novo--Yuen2017 G
BCO1     AU3782303chr16:
81295712-81295712
TGintronicDe novo--Yuen2017 G
BCO1     AU3765303chr16:
81317819-81317834
CTATATATATATATATCTATATATATATATintronicDe novo--Yuen2017 G
BCO1     2-0318-004chr16:
81305085-81305085
CTintronicDe novo--Yuen2017 G
BCO1     SSC03793chr16:
81301524-81301524
CAexonicDe novononsynonymous SNVNM_017429c.C631Ap.Q211K0.023-Lim2017 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More