or
or
Exact

Results for "FZR1"

Variant Events: 7

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FZR1     AU3852301chr19:
3513512-3513512
CTintronicDe novo--Yuen2017 G
FZR1     iHART3111chr19:
3527026-3527085
TCTCCCTACTCCCTGTCTCCCGTCAGCAACAAGAGGTGGGTCCCAGCTTCCTCCGCAGCCTexonicMaternalframeshift deletionNM_001136198
NM_016263
c.437_470del
c.437_470del
p.S146fs
p.S146fs
-6.658E-5Ruzzo2019 G
FZR1     iHART2070chr19:
3532545-3532545
GAexonicDe novononsynonymous SNVNM_001136197
NM_001136198
NM_016263
c.G872A
c.G1139A
c.G1139A
p.R291H
p.R380H
p.R380H
27.2-Ruzzo2019 G
FZR1     iHART3110chr19:
3527026-3527085
TCTCCCTACTCCCTGTCTCCCGTCAGCAACAAGAGGTGGGTCCCAGCTTCCTCCGCAGCCTexonicMaternalframeshift deletionNM_001136198
NM_016263
c.437_470del
c.437_470del
p.S146fs
p.S146fs
-6.658E-5Ruzzo2019 G
FZR1     2-0319-004chr19:
3530618-3530618
AGintronicDe novo--Yuen2017 G
FZR1     11808.p1chr19:
3527699-3527699
GAexonicMosaicnonsynonymous SNVNM_001136198
NM_016263
c.G541A
c.G541A
p.A181T
p.A181T
29.4-Dou2017 E
Krupp2017 E
FZR1     13910.p1chr19:
3532022-3532022
CTexonicDe novononsynonymous SNVNM_001136197
NM_001136198
NM_016263
c.C670T
c.C937T
c.C937T
p.R224W
p.R313W
p.R313W
24.1-Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More