or
or
Exact

Results for "IMPG1"

Variant Events: 98

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
IMPG1     AU031403chr6:
77111539-77111539
TCintergenicDe novo--Yuen2017 G
IMPG1     iHART1264chr6:
76660308-76660308
GAexonicMaternalstopgainNM_001282368
NM_001563
c.C1561T
c.C1795T
p.R521X
p.R599X
40.0-Ruzzo2019 G
IMPG1     1-0175-003chr6:
77062779-77062779
TAintergenicDe novo--Yuen2017 G
IMPG1     2-1521-003chr6:
77468045-77468045
ACintergenicDe novo--Yuen2017 G
IMPG1     7-0183-003chr6:
77853625-77853625
AGintergenicDe novo--Yuen2017 G
IMPG1     2-0033-003chr6:
77559999-77559999
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
IMPG1     1-0465-003achr6:
77652948-77652948
GAintergenicDe novo--Yuen2017 G
IMPG1     7-0095-004chr6:
76893991-76893998
AGTATCTGAintergenicDe novo--Yuen2017 G
IMPG1     7-0095-004chr6:
77872289-77872289
AAATTTGTATCintergenicDe novo--Yuen2017 G
IMPG1     1-0218-003chr6:
77922453-77922462
ATTTCCTTCGAintergenicDe novo--Yuen2017 G
IMPG1     2-1729-003chr6:
77606426-77606426
CGintergenicDe novo--Yuen2017 G
IMPG1     AU056005chr6:
78083891-78083891
CTintergenicDe novo--Yuen2017 G
IMPG1     2-1366-004chr6:
77211369-77211369
AGintergenicDe novo--Yuen2017 G
IMPG1     1-0208-003chr6:
76825103-76825103
GCintergenicDe novo--Yuen2017 G
IMPG1     2-1366-004chr6:
76866594-76866594
CTintergenicDe novo--Yuen2017 G
IMPG1     1-0045-003chr6:
77715737-77715738
TGTintergenicDe novo--Yuen2017 G
IMPG1     2-1645-003chr6:
76969206-76969206
CTintergenicDe novo--Yuen2017 G
IMPG1     5-0064-003chr6:
77195195-77195195
GAintergenicDe novo--Yuen2017 G
IMPG1     2-0003-004chr6:
77751040-77751040
AGintergenicDe novo--Yuen2017 G
IMPG1     AU4173301chr6:
77075503-77075503
CTintergenicDe novo--Yuen2017 G
IMPG1     AU051503chr6:
77123096-77123096
AGintergenicDe novo--Yuen2017 G
IMPG1     AU1988301chr6:
77818678-77818678
TCintergenicDe novo--Yuen2017 G
IMPG1     1-0345-004chr6:
78166069-78166069
CTintergenicDe novo--Yuen2017 G
IMPG1     2-1299-003chr6:
77142666-77142666
GAintergenicDe novo--Yuen2017 G
IMPG1     1-0299-004chr6:
77678560-77678560
CTintergenicDe novo--Yuen2017 G
IMPG1     1-0763-003chr6:
77383544-77383544
GTintergenicDe novo--Yuen2017 G
IMPG1     1-0763-003chr6:
77188366-77188366
GTintergenicDe novo--Yuen2017 G
IMPG1     AU038204chr6:
77028863-77028867
CAAAACAAAintergenicDe novo--Yuen2017 G
IMPG1     1-0460-003chr6:
77000189-77000189
CAintergenicDe novo--Yuen2017 G
IMPG1     1-0683-003chr6:
77746265-77746265
GTintergenicDe novo--Yuen2017 G
IMPG1     AU024608chr6:
77778751-77778751
CAintergenicDe novo--Yuen2017 G
IMPG1     5-0116-003chr6:
77015500-77015505
ATCTCTATCTintergenicDe novo--Yuen2017 G
IMPG1     AU4060306chr6:
77422508-77422508
GCintergenicDe novo--Yuen2017 G
IMPG1     1-0175-004chr6:
77062779-77062779
TAintergenicDe novo--Yuen2017 G
IMPG1     1-0715-003chr6:
77804457-77804457
CAintergenicDe novo--Yuen2017 G
IMPG1     AU030804chr6:
77004823-77004823
AGintergenicDe novo--Yuen2017 G
IMPG1     2-0214-003chr6:
76795045-76795045
AGintergenicDe novo--Yuen2017 G
IMPG1     AU4223302chr6:
78131554-78131554
CGintergenicDe novo--Yuen2017 G
IMPG1     1-0344-003chr6:
77347186-77347186
TCintergenicDe novo--Yuen2017 G
IMPG1     2-1241-003chr6:
77293180-77293184
TTTTGTintergenicDe novo--Yuen2016 G
IMPG1     1-0269-003chr6:
77925772-77925772
CTintergenicDe novo--Yuen2017 G
IMPG1     1-0028-003chr6:
77243827-77243827
AGintergenicDe novo--Yuen2017 G
IMPG1     1-0218-004chr6:
76979096-76979096
CTintergenicDe novo--Yuen2017 G
IMPG1     1-0028-003chr6:
77244843-77244843
GAintergenicDe novo--Yuen2017 G
IMPG1     5-0033-004chr6:
77888239-77888239
TAintergenicDe novo--Yuen2017 G
IMPG1     5-0033-004chr6:
77889684-77889684
AGintergenicDe novo--Yuen2017 G
IMPG1     2-1577-003chr6:
78078706-78078706
TCintergenicDe novo--Yuen2017 G
IMPG1     1-0513-003chr6:
76652614-76652614
GCintronicDe novo--Yuen2016 G
Yuen2017 G
IMPG1     2-0028-003chr6:
77921901-77921901
CGintergenicDe novo--Yuen2017 G
IMPG1     2-1329-003chr6:
77715810-77715810
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
IMPG1     AU3997301chr6:
78147140-78147140
GAintergenicDe novo--Yuen2017 G
IMPG1     AU2525302chr6:
77868085-77868085
GAintergenicDe novo--Yuen2017 G
IMPG1     AU071804chr6:
77063843-77063870
AACACACACACACACATACACACACACAAACACACACACACATACACACACACAintergenicDe novo--Yuen2017 G
IMPG1     AU4239301chr6:
77469806-77469806
CTintergenicDe novo--Yuen2017 G
IMPG1     1-0323-004chr6:
77861672-77861672
CTintergenicDe novo--Yuen2017 G
IMPG1     2-1429-004chr6:
77478798-77478798
CAintergenicDe novo--Yuen2017 G
IMPG1     7-0078-003chr6:
77601433-77601433
TCintergenicDe novo--Yuen2017 G
IMPG1     7-0058-003chr6:
77185680-77185681
AGAintergenicDe novo--Yuen2017 G
IMPG1     2-0144-003chr6:
77106813-77106813
GAintergenicDe novo--Yuen2017 G
IMPG1     1-0745-003chr6:
77230467-77230467
GAintergenicDe novo--Yuen2017 G
IMPG1     AU3964302chr6:
76645635-76645635
CAintronicDe novo--Yuen2017 G
IMPG1     AU3964302chr6:
77208816-77208816
ATintergenicDe novo--Yuen2017 G
IMPG1     1-0465-003chr6:
77652948-77652948
GAintergenicDe novo--Yuen2017 G
IMPG1     7-0197-003chr6:
77200675-77200675
CAintergenicDe novo--Yuen2017 G
IMPG1     13701.p1chr6:
76660802-76660802
CTexonicMosaicstopgainNM_001282368
NM_001563
c.G1067A
c.G1301A
p.W356X
p.W434X
25.0-Dou2017 E
Krupp2017 E
IMPG1     AU073005chr6:
76905073-76905079
ATTTTTTATTTTTintergenicDe novo--Yuen2017 G
IMPG1     AU1668302chr6:
77341105-77341105
GAintergenicDe novo--Yuen2017 G
IMPG1     AU031003chr6:
77737592-77737592
GCintergenicDe novo--Yuen2017 G
IMPG1     2-1315-003chr6:
76658727-76658727
CGintronicDe novo--Yuen2016 G
Yuen2017 G
IMPG1     2-1315-003chr6:
76658758-76658758
AGintronicDe novo--Yuen2016 G
Yuen2017 G
IMPG1     AU047703chr6:
76654405-76654405
AGintronicDe novo--Yuen2017 G
IMPG1     A32chr6:
77265003-77265003
TCintergenicDe novo--Wu2018 G
IMPG1     AU3712301chr6:
77574824-77574838
CTTTTATTTTATTTTCTTTTATTTTintergenicDe novo--Yuen2017 G
IMPG1     11089.p1chr6:
77136387-77136387
GAintergenicDe novo--Turner2016 G
IMPG1     12498.p1chr6:
77408489-77408489
AGintergenicDe novo--Turner2016 G
IMPG1     13874.p1chr6:
76677638-76677638
CAintronicDe novo--Turner2016 G
IMPG1     2-0270-003chr6:
77968632-77968632
TTCTTTCTTTCTCTCTCTCTCTTTCintergenicDe novo--Yuen2017 G
IMPG1     11572.p1chr6:
77549678-77549678
TCintergenicDe novo--Turner2016 G
IMPG1     12493.p1chr6:
77725668-77725668
GCintergenicDe novo--Turner2016 G
IMPG1     1-0756-003chr6:
77535615-77535615
AGintergenicDe novo--Yuen2017 G
IMPG1     A29chr6:
77836103-77836103
GAintergenicDe novo--Wu2018 G
IMPG1     2-1254-003chr6:
77504789-77504789
TCintergenicDe novo--Yuen2016 G
IMPG1     AU4067301chr6:
78059241-78059241
CTintergenicDe novo--Yuen2017 G
IMPG1     2-0012-003chr6:
76888313-76888313
TCintergenicDe novo--Yuen2017 G
IMPG1     AU3911302chr6:
76916854-76916854
GAintergenicDe novo--Yuen2017 G
IMPG1     1-0303-004chr6:
77826806-77826806
CTintergenicDe novo--Yuen2017 G
IMPG1     AU050603chr6:
76909083-76909083
GAintergenicDe novo--Yuen2017 G
IMPG1     2-0028-003chr6:
76741130-76741130
TAintronicDe novo--Yuen2016 G
IMPG1     1-0699-003chr6:
77761872-77761872
GTintergenicDe novo--Yuen2017 G
IMPG1     3-0134-000chr6:
77316994-77316994
ATintergenicDe novo--Yuen2017 G
IMPG1     1-0025-004chr6:
78017248-78017248
TGintergenicDe novo--Yuen2017 G
IMPG1     2-1295-003chr6:
78109716-78109716
GTintergenicDe novo--Yuen2017 G
IMPG1     A32chr6:
76773506-76773506
TGintronicDe novo--Wu2018 G
IMPG1     1-0520-003chr6:
77741620-77741620
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
IMPG1     2-1379-003chr6:
76826836-76826836
AGintergenicDe novo--Yuen2017 G
IMPG1     7-0249-004chr6:
76682793-76682793
CTintronicDe novo--Yuen2017 G
IMPG1     5-0040-003chr6:
76776931-76776931
TTAAintronicDe novo--Yuen2017 G
IMPG1     2-1194-003chr6:
77615527-77615527
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More