or
or
Exact

Results for "FOXK2"

Variant Events: 20

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FOXK2     PN400367chr17:
80543936-80543936
CTexonicUnknownnonsynonymous SNVNM_004514c.C1436Tp.A479V28.40.0027Leblond2019 E
FOXK2     PN400407chr17:
80477918-80477918
CTexonicUnknownnonsynonymous SNVNM_004514c.C154Tp.R52C17.890.0038Leblond2019 E
FOXK2     AU076808chr17:
80566084-80566084
GAintergenicDe novo--Yuen2017 G
FOXK2     MR_315chr17:
80544081-80544081
GGCGGAGGGGAAAGGAGGAGAGGGGAGACCACAGGGAGGTGAAAGGTGGGCintronicDe novo--Satterstrom2020 E
FOXK2     1-0661-003chr17:
80500308-80500309
CTCTTintronicDe novo--Yuen2017 G
FOXK2     14338.p1chr17:
80559225-80559225
GAexonicMosaicsynonymous SNVNM_004514c.G1833Ap.S611S0.4682.0E-4Dou2017 E
Krupp2017 E
FOXK2     PN400470chr17:
80477918-80477918
CTexonicUnknownnonsynonymous SNVNM_004514c.C154Tp.R52C17.890.0038Leblond2019 E
FOXK2     PN400524chr17:
80543936-80543936
CTexonicUnknownnonsynonymous SNVNM_004514c.C1436Tp.A479V28.40.0027Leblond2019 E
FOXK2     SSC10320chr17:
80545012-80545012
GAexonicDe novosynonymous SNVNM_004514c.G1650Ap.Q550Q--Lim2017 E
FOXK2     14162.p1chr17:
80540643-80540643
GCexonicDe novosynonymous SNVNM_004514c.G936Cp.L312L-8.343E-6Iossifov2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Wilfert2021 G
FOXK2     14004.p1chr17:
80545012-80545012
GAexonicDe novosynonymous SNVNM_004514c.G1650Ap.Q550Q--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
FOXK2     NDAR_INVRU232AAR_wes1chr17:
80543909-80543909
CTexonicDe novononsynonymous SNVNM_004514c.C1409Tp.T470M22.52.0E-4DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
FOXK2     1-0120-003chr17:
80537335-80537335
TCintronicDe novo--Yuen2017 G
FOXK2     DEASD_0160_001chr17:
80544976-80544976
GAexonicDe novosynonymous SNVNM_004514c.G1614Ap.T538T-5.0E-4DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
FOXK2     PN400412chr17:
80543936-80543936
CTexonicUnknownnonsynonymous SNVNM_004514c.C1436Tp.A479V28.40.0027Leblond2019 E
FOXK2     PN400474chr17:
80477918-80477918
CTexonicUnknownnonsynonymous SNVNM_004514c.C154Tp.R52C17.890.0038Leblond2019 E
FOXK2     PN400282chr17:
80477918-80477918
CTexonicUnknownnonsynonymous SNVNM_004514c.C154Tp.R52C17.890.0038Leblond2019 E
FOXK2     7-0255-003chr17:
80544081-80544082
GCGCCintronicDe novo--Yuen2017 G
FOXK2     PN400393chr17:
80477918-80477918
CTexonicUnknownnonsynonymous SNVNM_004514c.C154Tp.R52C17.890.0038Leblond2019 E
FOXK2     PN400171chr17:
80477918-80477918
CTexonicUnknownnonsynonymous SNVNM_004514c.C154Tp.R52C17.890.0038Leblond2019 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More