or
or
Exact

Results for "LAMA1"

Variant Events: 37

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LAMA1     PN400534chr18:
7049171-7049171
CTexonicUnknownnonsynonymous SNVNM_005559c.G674Ap.R225H33.00.0064Leblond2019 E
LAMA1     2-1366-004chr18:
7146746-7146746
AGintergenicDe novo--Yuen2017 G
LAMA1     2-1337-003chr18:
7172947-7172947
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LAMA1     2-1510-003chr18:
7225292-7225312
GTATTATTATTATTATTATTAGTATTATTATTATTATTAintergenicDe novo--Yuen2017 G
LAMA1     PN400544chr18:
7032153-7032153
CTexonicUnknownnonsynonymous SNVNM_005559c.G2186Ap.R729H28.30.0026Leblond2019 E
LAMA1     08C75329chr18:
7010164-7010164
TTTTAintronicDe novo--Satterstrom2020 E
LAMA1     PN400179chr18:
7032153-7032153
CTexonicUnknownnonsynonymous SNVNM_005559c.G2186Ap.R729H28.30.0026Leblond2019 E
LAMA1     2-1709-003chr18:
7177943-7177943
CTintergenicDe novo--Yuen2017 G
LAMA1     11225.p1chr18:
6977778-6977778
TAexonicMosaicnonsynonymous SNVNM_005559c.A6293Tp.N2098I22.6-Dou2017 E
LAMA1     Codina-Sola2015:ASD_35chr18:
6999495-6999495
GAexonicMaternalnonsynonymous SNVNM_005559c.C4612Tp.R1538W14.452.0E-4Codina-Sola2015 E
LAMA1     AU4327303chr18:
7085618-7085618
CTintronicDe novo--Yuen2017 G
LAMA1     PN400119chr18:
7049171-7049171
CTexonicUnknownnonsynonymous SNVNM_005559c.G674Ap.R225H33.00.0064Leblond2019 E
LAMA1     AU3729301chr18:
7226710-7226710
TCintergenicDe novo--Yuen2017 G
LAMA1     PN400548chr18:
7049171-7049171
CTexonicUnknownnonsynonymous SNVNM_005559c.G674Ap.R225H33.00.0064Leblond2019 E
LAMA1     PN400100chr18:
7049171-7049171
CTexonicUnknownnonsynonymous SNVNM_005559c.G674Ap.R225H33.00.0064Leblond2019 E
LAMA1     PN400246chr18:
7049171-7049171
CTexonicUnknownnonsynonymous SNVNM_005559c.G674Ap.R225H33.00.0064Leblond2019 E
LAMA1     PN400264chr18:
7049171-7049171
CTexonicUnknownnonsynonymous SNVNM_005559c.G674Ap.R225H33.00.0064Leblond2019 E
LAMA1     PN400281chr18:
7049171-7049171
CTexonicUnknownnonsynonymous SNVNM_005559c.G674Ap.R225H33.00.0064Leblond2019 E
LAMA1     12289.p1chr18:
6958523-6958523
CTexonicDe novononsynonymous SNVNM_005559c.G7917Ap.M2639I1.786-Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
Wilfert2021 G
LAMA1     PN400281chr18:
6965301-6965301
CTexonicUnknownnonsynonymous SNVNM_005559c.G7181Ap.R2394Q35.09.884E-5Leblond2019 E
LAMA1     1-0699-003chr18:
6982338-6982338
CTintronicDe novo--Yuen2017 G
LAMA1     PN400533chr18:
7032153-7032153
CTexonicUnknownnonsynonymous SNVNM_005559c.G2186Ap.R729H28.30.0026Leblond2019 E
LAMA1     AU4314302chr18:
6982448-6982448
CTintronicDe novo-5.766E-5Yuen2017 G
LAMA1     PN400546chr18:
7049171-7049171
CTexonicUnknownnonsynonymous SNVNM_005559c.G674Ap.R225H33.00.0064Leblond2019 E
LAMA1     SP0025437chr18:
7038938-7038938
CTexonicDe novosynonymous SNVNM_005559c.G1434Ap.E478E--Feliciano2019 E
LAMA1     PN400323chr18:
6965341-6965341
GAexonicUnknownnonsynonymous SNVNM_005559c.C7141Tp.R2381C25.00.0024Leblond2019 E
LAMA1     PN400396chr18:
7049171-7049171
CTexonicUnknownnonsynonymous SNVNM_005559c.G674Ap.R225H33.00.0064Leblond2019 E
LAMA1     11552.p1chr18:
7034440-7034440
CAintronicDe novo--Satterstrom2020 E
LAMA1     1-0253-004chr18:
7145382-7145382
CTintergenicDe novo--Yuen2017 G
LAMA1     PN400524chr18:
7032153-7032153
CTexonicUnknownnonsynonymous SNVNM_005559c.G2186Ap.R729H28.30.0026Leblond2019 E
LAMA1     08C74292chr18:
7042128-7042128
TGintronicDe novo--Satterstrom2020 E
LAMA1     AU3635301chr18:
7069483-7069483
CTintronicDe novo--Yuen2017 G
LAMA1     PN400195chr18:
7032153-7032153
CTexonicUnknownnonsynonymous SNVNM_005559c.G2186Ap.R729H28.30.0026Leblond2019 E
LAMA1     PN400568chr18:
7032153-7032153
CTexonicUnknownnonsynonymous SNVNM_005559c.G2186Ap.R729H28.30.0026Leblond2019 E
LAMA1     DEASD_0407_001chr18:
7032103-7032103
CTexonicDe novononsynonymous SNVNM_005559c.G2236Ap.G746S13.931.651E-5DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
LAMA1     PN400292chr18:
7049171-7049171
CTexonicUnknownnonsynonymous SNVNM_005559c.G674Ap.R225H33.00.0064Leblond2019 E
LAMA1     2-1361-003chr18:
7040539-7040539
CTintronicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More