or
or
Exact

Results for "ZNF521"

Variant Events: 42

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ZNF521     1-0534-004chr18:
23241115-23241115
CGintergenicDe novo--Yuen2017 G
ZNF521     7-0255-003chr18:
23222777-23222777
GAintergenicDe novo--Yuen2017 G
ZNF521     AU3885304chr18:
22877494-22877494
TGintronicDe novo--Yuen2017 G
ZNF521     2-1389-003chr18:
23381969-23381969
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
ZNF521     5-0033-004chr18:
23141980-23141980
AACTintergenicDe novo--Yuen2017 G
ZNF521     2-1163-003chr18:
23190915-23190915
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
ZNF521     2-1417-003chr18:
23465372-23465372
TCintergenicDe novo--Yuen2017 G
ZNF521     2-0215-003chr18:
23020611-23020611
GAintergenicDe novo--Yuen2017 G
ZNF521     F10297-1chr18:
22642753-22642753
AAAAGintronicDe novo--Satterstrom2020 E
ZNF521     13171.p1chr18:
23245663-23245663
CTintergenicDe novo--Turner2016 G
ZNF521     13539.p1chr18:
22897117-22897117
GAintronicDe novo--Turner2016 G
ZNF521     AU0452303chr18:
23556927-23556927
CAintergenicDe novo--Yuen2017 G
ZNF521     1-0402-003chr18:
22664658-22664658
TAintronicDe novo--Yuen2017 G
ZNF521     2-1696-003chr18:
23003669-23003669
ACintergenicDe novo--Yuen2017 G
ZNF521     7-0253-003chr18:
23482077-23482093
TTCTCTCTCTCTCTCTCTTCTCTCTCTCTCTCintergenicDe novo--Yuen2017 G
ZNF521     AU072505chr18:
22856607-22856607
GAintronicDe novo--Yuen2017 G
ZNF521     7-0148-003chr18:
22762812-22762824
TCTTTACCTTTACTCTTTACintronicDe novo--Yuen2017 G
ZNF521     1-0357-003chr18:
23075614-23075614
TAintergenicDe novo--Yuen2017 G
ZNF521     2-1288-003chr18:
23305354-23305354
GAintergenicDe novo--Yuen2017 G
ZNF521     AU2863303chr18:
23546965-23546965
ACintergenicDe novo--Yuen2017 G
ZNF521     7-0068-003chr18:
23215101-23215101
GAintergenicDe novo--Yuen2017 G
ZNF521     AU4145301chr18:
23388780-23388780
AGintergenicDe novo--Yuen2017 G
ZNF521     AU4176302chr18:
22926022-22926028
GAAAAAAGAAAAAAAintronicDe novo--Yuen2017 G
ZNF521     7-0058-003chr18:
23498280-23498280
TCintergenicDe novo--Yuen2017 G
ZNF521     2-1357-003chr18:
22734701-22734701
GAintronicDe novo--Yuen2017 G
ZNF521     AU3951302chr18:
23501945-23501950
TATGATTATintergenicDe novo--Yuen2017 G
ZNF521     AU3729303chr18:
23586061-23586061
ATintergenicDe novo--Yuen2017 G
ZNF521     AU066206chr18:
23410797-23410797
GAintergenicDe novo--Yuen2017 G
ZNF521     11479.p1chr18:
23383992-23383992
ATintergenicMosaic--Dou2017 E
ZNF521     AU3857301chr18:
22699084-22699084
GAintronicDe novo--Yuen2017 G
ZNF521     1-0052-003chr18:
23427128-23427128
CTintergenicDe novo--Yuen2017 G
ZNF521     AU3857301chr18:
23078240-23078240
AGintergenicDe novo--Yuen2017 G
ZNF521     1-0820-003chr18:
23271303-23271303
GAintergenicDe novo--Yuen2017 G
ZNF521     AU3371302chr18:
23459392-23459392
CGintergenicDe novo--Yuen2017 G
ZNF521     13034.p1chr18:
22807228-22807228
GAexonicMosaicsynonymous SNVNM_015461c.C654Tp.H218H-4.122E-5Dou2017 E
ZNF521     AU1795303chr18:
22768038-22768038
AGintronicDe novo--Yuen2017 G
ZNF521     AU1933302chr18:
23394107-23394107
CAintergenicDe novo--Yuen2017 G
ZNF521     AU3765303chr18:
23161343-23161343
TAintergenicDe novo--Yuen2017 G
ZNF521     1-0458-003chr18:
22930151-22930151
CTintronicDe novo--Yuen2017 G
ZNF521     08C74336chr18:
22805820-22805820
TCexonicDe novononsynonymous SNVNM_001308225
NM_015461
c.A1402G
c.A2062G
p.M468V
p.M688V
8.301-Satterstrom2020 E
ZNF521     7-0188-003chr18:
22791503-22791503
TCintronicDe novo--Yuen2017 G
ZNF521     AU2793301chr18:
22905609-22905609
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More