or
or
Exact

Results for "MYO16"

Variant Events: 36

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MYO16     1-0259-005chr13:
110000613-110000613
AAAAAAGintergenicDe novo--Yuen2017 G
MYO16     AU026412chr13:
109492370-109492370
CAintronicDe novo--Yuen2017 G
MYO16     AU3811301chr13:
109990482-109990482
CTintergenicDe novo--Yuen2017 G
MYO16     AU4429301chr13:
109854870-109854872
CAACAAAAintronicDe novo--Yuen2017 G
MYO16     2-0013-003chr13:
109878303-109878303
GAintergenicDe novo--Yuen2017 G
MYO16     AU3905301chr13:
109456973-109456973
AGintronicDe novo--Yuen2017 G
MYO16     1-0706-003chr13:
109318193-109318193
TCintronicDe novo--Yuen2017 G
MYO16     2-1174-006chr13:
109744203-109744203
AGintronicDe novo--Yuen2017 G
MYO16     2-1184-003chr13:
109727269-109727269
TGintronicDe novo--Yuen2016 G
Yuen2017 G
MYO16     2-0214-003chr13:
109976068-109976068
AACATCintergenicDe novo--Yuen2017 G
MYO16     AU3794302chr13:
109871697-109871697
GAintergenicDe novo--Yuen2017 G
MYO16     2-1426-003chr13:
109600723-109600723
GAintronicDe novo--Yuen2017 G
MYO16     1-0571-003chr13:
109406538-109406538
CTintronicDe novo--Yuen2017 G
MYO16     1-0923-003chr13:
109527648-109527648
AGintronicDe novo--Yuen2017 G
MYO16     2-1265-003chr13:
109848638-109848638
GAintronicDe novo--Yuen2016 G
Yuen2017 G
MYO16     Codina-Sola2015:ASD_36chr13:
109644794-109644798
CAAGTCexonicMaternalframeshift deletionNM_001198950
NM_015011
c.2441_2442del
c.2375_2376del
p.Q814fs
p.Q792fs
--Codina-Sola2015 E
MYO16     1-0755-003chr13:
109418163-109418163
CTintronicDe novo--Yuen2017 G
MYO16     2-1353-003chr13:
109910961-109910961
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
MYO16     AU4093302chr13:
109495359-109495359
TCintronicDe novo--Yuen2017 G
MYO16     2-0214-004chr13:
109976068-109976068
AACATCintergenicDe novo--Yuen2017 G
MYO16     2-1094-005chr13:
109349276-109349276
GAintronicDe novo--Yuen2017 G
MYO16     AU1988302chr13:
109866061-109866061
GAintergenicDe novo--Yuen2017 G
MYO16     2-0149-005chr13:
109466098-109466100
CTTCintronicDe novo--Yuen2017 G
MYO16     AU076704chr13:
109845720-109845720
GAintronicDe novo--Yuen2017 G
MYO16     7-0128-003chr13:
109722108-109722108
TCintronicDe novo--Yuen2017 G
MYO16     5-0045-003chr13:
109920570-109920570
CAintergenicDe novo--Yuen2017 G
MYO16     AU3398301chr13:
109930901-109930901
GCintergenicDe novo--Yuen2017 G
MYO16     1-0552-003chr13:
109832890-109832890
CAintronicDe novo--Yuen2017 G
MYO16     A4chr13:
109317069-109317069
TCintronicDe novo--Wu2018 G
MYO16     1-0558-003chr13:
109628612-109628627
ATCTCTCTCTCTCTCTATCTCTCTCTCTCTintronicDe novo--Yuen2017 G
MYO16     11252.p1chr13:
109966286-109966286
TAintergenicDe novo--Turner2016 G
MYO16     11493.p1chr13:
109817311-109817311
GAexonicMosaicnonsynonymous SNVNM_001198950
NM_015011
c.G5227A
c.G5161A
p.E1743K
p.E1721K
18.661.676E-5Dou2017 E
MYO16     2-1362-004chr13:
109406035-109406035
CAintronicDe novo--Yuen2017 G
MYO16     2-1142-003chr13:
109586031-109586031
CTintronicDe novo--Yuen2017 G
MYO16     AU1933301chr13:
109907946-109907946
TCintergenicDe novo--Yuen2017 G
MYO16     7-0253-005chr13:
109578509-109578509
AGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More