or
or
Exact

Results for "EYA1"

Variant Events: 36

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
EYA1     AU050704chr8:
72470662-72470662
GAintergenicDe novo--Yuen2017 G
EYA1     AU4273304chr8:
72642823-72642824
TGTintergenicDe novo--Yuen2017 G
EYA1     1-0382-003chr8:
72558881-72558881
ATintergenicDe novo--Yuen2017 G
EYA1     AU3808304chr8:
72638687-72638687
CTintergenicDe novo--Yuen2017 G
EYA1     1-0736-003chr8:
72124949-72124949
GAintronicDe novo--Yuen2017 G
EYA1     1-0763-003chr8:
72206465-72206465
CTintronicDe novo--Yuen2017 G
EYA1     2-0297-004chr8:
72494200-72494200
GAintergenicDe novo--Yuen2017 G
EYA1     3-0661-000chr8:
72371752-72371752
GCintergenicDe novo--Yuen2017 G
EYA1     AU054103chr8:
72574506-72574508
CAACintergenicDe novo--Yuen2017 G
EYA1     AU3885305chr8:
72129201-72129201
TCexonicDe novononsynonymous SNVNM_172059
NM_172060
NM_172058
NM_000503
NM_001288574
NM_001288575
c.A1093G
c.A1099G
c.A1198G
c.A1198G
c.A1180G
c.A832G
p.S365G
p.S367G
p.S400G
p.S400G
p.S394G
p.S278G
16.11-Yuen2017 G
EYA1     5-0105-003chr8:
72491996-72491996
GAintergenicDe novo--Yuen2017 G
EYA1     AU3806304chr8:
72249861-72249861
AGintronicDe novo--Yuen2017 G
EYA1     13881.p1chr8:
72246332-72246332
CGexonicMosaic, De novononsynonymous SNVNM_172060
NM_172058
NM_172059
NM_000503
NM_001288574
c.G103C
c.G202C
c.G202C
c.G202C
c.G202C
p.A35P
p.A68P
p.A68P
p.A68P
p.A68P
25.1-Dou2017 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
EYA1     AU076704chr8:
72527400-72527400
GAintergenicDe novo--Yuen2017 G
EYA1     AU034903chr8:
72268961-72268961
GAintronicDe novo--Yuen2017 G
EYA1     1-0206-003chr8:
72206469-72206469
TCintronicDe novo--Yuen2017 G
EYA1     1-0546-003chr8:
72116774-72116774
AGintronicDe novo--Yuen2017 G
EYA1     1-0763-004chr8:
72676266-72676266
CAintergenicDe novo--Yuen2017 G
EYA1     1-0381-003chr8:
72728533-72728547
CAGAGAGAGAGAGAGCAGAGAGAGAGAGintergenicDe novo--Yuen2017 G
EYA1     A11chr8:
72743715-72743715
TCintergenicDe novo--Wu2018 G
EYA1     AU3713302chr8:
72643495-72643495
TCintergenicDe novo--Yuen2017 G
EYA1     13515.p1chr8:
72564038-72564038
TCintergenicDe novo--Turner2016 G
EYA1     2-1561-003chr8:
72346738-72346744
TAAAAAATAAAAAAAintergenicDe novo--Yuen2017 G
EYA1     AU000704chr8:
72321027-72321027
TAintergenicDe novo--Yuen2017 G
EYA1     1-0450-003chr8:
72276750-72276750
GAintergenicDe novo--Yuen2017 G
EYA1     1-0595-004chr8:
72206678-72206678
GGCintronicDe novo--Yuen2017 G
EYA1     1-0296-003chr8:
72382627-72382627
ACintergenicDe novo--Yuen2017 G
EYA1     AU070007chr8:
72639461-72639461
TCintergenicDe novo--Yuen2017 G
EYA1     SSC08607chr8:
72246332-72246332
CGexonicDe novononsynonymous SNVNM_172060
NM_172058
NM_172059
NM_000503
NM_001288574
c.G103C
c.G202C
c.G202C
c.G202C
c.G202C
p.A35P
p.A68P
p.A68P
p.A68P
p.A68P
25.1-Lim2017 E
EYA1     7-0097-003chr8:
72578389-72578389
CTintergenicDe novo--Yuen2017 G
EYA1     74-0688chr8:
72344451-72344451
GAintergenicDe novo--Michaelson2012 G
EYA1     1-0458-005chr8:
72719363-72719363
GAintergenicDe novo--Yuen2017 G
EYA1     5-0025-003chr8:
72206678-72206678
GGCintronicDe novo--Yuen2017 G
EYA1     5-0050-004chr8:
72206678-72206678
GGCintronicDe novo--Yuen2017 G
EYA1     2-0135-004chr8:
72166908-72166908
CTintronicDe novo--Yuen2017 G
EYA1     2-1461-003chr8:
72586395-72586395
CGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More