or
or
Exact

Results for "KLHDC7A"

Variant Events: 13

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KLHDC7A     iHART1704chr1:
18809147-18809147
CGexonicDe novononsynonymous SNVNM_152375c.C1672Gp.R558G17.35-Ruzzo2019 G
KLHDC7A     2-1509-003chr1:
18831510-18831526
TGAGAGAGAGAGAGAGATGAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
KLHDC7A     DEASD_0148_001chr1:
18809822-18809822
TGUTR3De novo--Kosmicki2017 E
Satterstrom2020 E
KLHDC7A     AU2035301chr1:
18918950-18918950
TCintergenicDe novo--Yuen2017 G
KLHDC7A     1-0978-003chr1:
18880699-18880699
TCintergenicDe novo--Yuen2017 G
KLHDC7A     1-0273-004chr1:
18943955-18943955
CTintergenicDe novo--Yuen2017 G
KLHDC7A     1-0450-003chr1:
18807481-18807481
CTexonicDe novosynonymous SNVNM_152375c.C6Tp.F2F--Yuen2017 G
KLHDC7A     5-0077-004chr1:
18827338-18827338
GAintergenicDe novo--Yuen2017 G
KLHDC7A     AU2035302chr1:
18918950-18918950
TCintergenicDe novo--Yuen2017 G
KLHDC7A     2-0285-003chr1:
18816488-18816488
GCintergenicDe novo--Yuen2017 G
KLHDC7A     AU1404301chr1:
18915561-18915561
GAintergenicDe novo--Yuen2017 G
KLHDC7A     11069.p1chr1:
18839782-18839782
CTintergenicMosaic--Dou2017 E
KLHDC7A     AU059903chr1:
18819501-18819516
TGAGAGAGAGAGAGAGTGAGAGAGAGAGAGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More