or
or
Exact

Results for "FAT3"

Variant Events: 53

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FAT3     1-0553-003chr11:
92467054-92467054
GAintronicDe novo--Yuen2017 G
FAT3     2-1085-003chr11:
92221565-92221565
AAAGCTGCTintronicDe novo--Yuen2017 G
FAT3     2-1382-003chr11:
92447888-92447888
TGintronicDe novo--Yuen2016 G
Yuen2017 G
FAT3     2-1738-003chr11:
92677798-92677798
CTintergenicDe novo--Yuen2017 G
FAT3     A21chr11:
92323259-92323259
CGintronicDe novo--Wu2018 G
FAT3     2-1370-003chr11:
92600180-92600180
GAexonicDe novononsynonymous SNVNM_001008781c.G11932Ap.V3978M27.6-Jiang2013 G
Yuen2016 G
Yuen2017 G
FAT3     1-0467-005chr11:
92559748-92559748
AGintronicDe novo--Yuen2017 G
FAT3     2-1244-003chr11:
92189889-92189890
GTGintronicDe novo--Yuen2016 G
Yuen2017 G
FAT3     10C105645chr11:
92600093-92600093
AGexonicDe novononsynonymous SNVNM_001008781c.A11845Gp.T3949A15.63-Satterstrom2020 E
FAT3     5-0140-003chr11:
92568521-92568521
CTintronicDe novo--Yuen2017 G
FAT3     7-0183-003chr11:
92289686-92289686
CTintronicDe novo--Yuen2017 G
FAT3     2-1382-003chr11:
92625344-92625356
AGTGTGTGTGTGTAGTGTGTGTGTUTR3De novo--Yuen2017 G
FAT3     1-0402-004chr11:
92580133-92580133
TCintronicDe novo--Yuen2017 G
FAT3     1-0514-003chr11:
92416152-92416152
GCintronicDe novo--Yuen2016 G
Yuen2017 G
FAT3     2-0264-004chr11:
92264576-92264576
GAintronicDe novo--Yuen2017 G
FAT3     2-0202-003chr11:
92186130-92186130
GCintronicDe novo--Yuen2017 G
FAT3     14672.p1chr11:
92087350-92087350
ACexonicDe novononsynonymous SNVNM_001008781c.A2072Cp.K691T8.9858.343E-6Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
FAT3     1-0403-004chr11:
92479416-92479416
CAintronicDe novo--Yuen2017 G
FAT3     13107.p1chr11:
92523301-92523301
CTexonicDe novononsynonymous SNVNM_001008781c.C4528Tp.R1510W23.04.146E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
FAT3     1-0863-003chr11:
92477528-92477528
GCintronicDe novo--Yuen2017 G
FAT3     11202.p1chr11:
92533228-92533228
GAexonicMosaic, De novononsynonymous SNVNM_001008781c.G7049Ap.R2350Q16.66-Dou2017 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
FAT3     1-0352-005chr11:
92634006-92634006
GCintergenicDe novo--Yuen2017 G
FAT3     7-0249-003chr11:
92264400-92264400
CTintronicDe novo--Yuen2017 G
FAT3     AU076509chr11:
92677001-92677001
CTintergenicDe novo--Yuen2017 G
FAT3     2-1258-004chr11:
92520292-92520292
CTintronicDe novo--Yuen2017 G
FAT3     AU009903chr11:
92157798-92157798
CTintronicDe novo--Yuen2017 G
FAT3     2-1507-003chr11:
92496405-92496405
CTintronicDe novo--Yuen2017 G
FAT3     11990.p1chr11:
92355213-92355213
CGintronicDe novo--Werling2018 G
FAT3     2-1166-003chr11:
92432819-92432819
TCintronicDe novo--Yuen2016 G
Yuen2017 G
FAT3     2-1620-004chr11:
92489281-92489281
TAintronicDe novo--Yuen2017 G
FAT3     AU2019302chr11:
92126405-92126405
TCintronicDe novo--Yuen2017 G
FAT3     2-1620-004chr11:
92608471-92608471
CAintronicDe novo--Yuen2017 G
FAT3     A10chr11:
92147137-92147137
GTintronicDe novo--Wu2018 G
FAT3     2-1461-003chr11:
92647844-92647844
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
FAT3     PN400137chr11:
92569867-92569867
CTexonicUnknownnonsynonymous SNVNM_001008781c.C10222Tp.R3408W17.880.0022Leblond2019 E
FAT3     PN400424chr11:
92569867-92569867
CTexonicUnknownnonsynonymous SNVNM_001008781c.C10222Tp.R3408W17.880.0022Leblond2019 E
FAT3     AU030104chr11:
92611819-92611834
AAAAAAAAAAAAAAAGAintronicDe novo--Yuen2017 G
FAT3     1-0820-003chr11:
92328158-92328158
AGintronicDe novo--Yuen2017 G
FAT3     1-0403-003chr11:
92417924-92417924
CTintronicDe novo--Yuen2017 G
FAT3     5-0004-003chr11:
92189734-92189734
TCintronicDe novo--Yuen2017 G
FAT3     1-0121-003chr11:
92277974-92277974
GCintronicDe novo--Yuen2017 G
FAT3     11341.p1chr11:
92243124-92243124
AGintronicDe novo--Turner2016 G
FAT3     2-1632-003chr11:
92300353-92300353
ATintronicDe novo--Yuen2017 G
FAT3     AU2089302chr11:
92114429-92114429
GAintronicDe novo--Yuen2017 G
FAT3     1-0757-003chr11:
92374287-92374287
ATintronicDe novo--Yuen2017 G
FAT3     AU4308302chr11:
92538632-92538632
TAintronicDe novo--Yuen2017 G
FAT3     DEASD_0386_001chr11:
92258103-92258103
AGexonicDe novononsynonymous SNVNM_001008781c.A3596Gp.N1199S23.20.0014DeRubeis2014 E
Kosmicki2017 E
FAT3     2-0081-003chr11:
92583250-92583250
AGintronicDe novo--Yuen2017 G
FAT3     2-1454-003chr11:
92515311-92515332
CAATAATAATAATAATAATAATCAATAATAATAATAATAATintronicDe novo--Yuen2017 G
FAT3     2-1562-004chr11:
92671970-92671970
GGTTGTCTTTGGATATACTACAGCGATGGCTATTGAGGAGTATintergenicDe novo--Yuen2017 G
FAT3     1-0292-005chr11:
92126875-92126875
CTintronicDe novo--Yuen2017 G
FAT3     Lim2017:70233chr11:
92533228-92533228
GAexonicDe novononsynonymous SNVNM_001008781c.G7049Ap.R2350Q16.66-Lim2017 E
FAT3     Lim2017:70534chr11:
92087350-92087350
ACexonicDe novononsynonymous SNVNM_001008781c.A2072Cp.K691T8.9858.343E-6Lim2017 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More