
Results for "SHANK2"

Variant Events: 227

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
SHANK2     2-1129-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2016 G
Yuen2017 G
SHANK2     1-0677-003chr11:
CGintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     7-0174-003chr11:
TGintergenicDe novo--Yuen2017 G
SHANK2     1-0253-004chr11:
CTintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     1-0530-003chr11:
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
SHANK2     12380.p1chr11:
CTGCexonicDe novo, Unknownframeshift deletionNM_133266c.2540_2541delp.S847fs--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Wang2020 T
Wilfert2021 G
Willsey2013 E
Zhou2022 GE
SHANK2     1-0169-004chr11:
AGintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     2-1391-004chr11:
AGAintronicDe novo--Yuen2017 G
SHANK2     74-0115chr11:
ACintergenicDe novo--Michaelson2012 G
SHANK2     3-0456-000chr11:
CTintronicDe novo--Yuen2016 G
Yuen2017 G
SHANK2     AU071703chr11:
CTexonicUnknownunknown24.64.601E-5Stessman2017 T
SHANK2     AU054304chr11:
CTintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     ACGC_M15036chr11:
GAexonicUnknownsynonymous SNVNM_133266c.C2082Tp.Y694Y-3.298E-5Wang2020 T
SHANK2     AU2075301chr11:
GAintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     Leuven2_60356400chr11:
GAexonicUnknownunknown17.19-Wang2020 T
SHANK2     Leuven_405458chr11:
GAexonicUnknownunknown17.19-Wang2020 T
SHANK2     1-0075-003chr11:
CTintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     PN400501chr11:
CTexonicUnknownunknown24.20.0049Leblond2019 E
SHANK2     AGRE_AU071703chr11:
CTexonicUnknownunknown24.64.601E-5Wang2020 T
SHANK2     AGRE_03C16378chr11:
CTexonicUnknownunknown24.64.601E-5Wang2020 T
SHANK2     2-0298-003chr11:
AGintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     1-0455-004chr11:
AGintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     M03813chr11:
CTexonicMaternalnonsynonymous SNVNM_133266c.G1736Ap.G579D3.12-Guo2018 T
SHANK2     3-0456-000Bchr11:
CTintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     M19664chr11:
CAexonicMaternalunknown12.27-Guo2018 T
SHANK2     M08314chr11:
AGexonicMaternalunknown15.42-Guo2018 T
SHANK2     M20738chr11:
AA/GexonicMaternal--Guo2018 T
SHANK2     M23679chr11:
TGexonicMaternalnonsynonymous SNVNM_133266c.A709Cp.T237P9.687-Guo2018 T
SHANK2     TASC_211-5435-4chr11:
GAexonicUnknownunknown18.94-Wang2020 T
SHANK2     M16089chr11:
CTexonicMaternalnonsynonymous SNVNM_133266c.G1456Ap.V486I11.883.471E-5Guo2018 T
SHANK2     Leuven_299053chr11:
GAexonicUnknownunknown18.94-Wang2020 T
SHANK2     M08485chr11:
GAexonicMaternalnonsynonymous SNVNM_133266c.C527Tp.S176L17.49-Guo2018 T
SHANK2     M08515chr11:
TGexonicMaternalnonsynonymous SNVNM_133266c.A709Cp.T237P9.687-Guo2018 T
SHANK2     ACGC_HN0112.p1chr11:
GCexonicDe novostopgainNM_133266c.C87Gp.Y29X37.0-Wang2020 T
SHANK2     2-1207-003chr11:
GAintronicDe novo--Yuen2016 G
Yuen2017 G
SHANK2     Gecz4_48759chr11:
CTexonicUnknownunknown20.2-Wang2020 T
SHANK2     ACGC_HEN0171.p1chr11:
CTexonicUnknownunknown20.2-Wang2020 T
SHANK2     108070-100chr11:
CGexonicUnknownunknown26.2-Stessman2017 T
SHANK2     2-0198-003chr11:
GAintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     2-1131-003chr11:
CGintergenicDe novo--Yuen2017 G
SHANK2     2-0299-003chr11:
CTintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     HN0074.p1chr11:
CTexonicPaternalnonsynonymous SNVNM_133266c.G2191Ap.V731M17.178.24E-6Guo2018 T
SHANK2     GX0325.p1chr11:
AGexonicPaternalnonsynonymous SNVNM_133266c.T767Cp.M256T15.988.243E-6Guo2018 T
SHANK2     HN0037.p1chr11:
CGexonicPaternalnonsynonymous SNVNM_133266c.G1722Cp.E574D6.322-Guo2018 T
SHANK2     Leuven_305385chr11:
CTexonicUnknownnonsynonymous SNVNM_133266c.G268Ap.G90R32.01.65E-5Wang2020 T
SHANK2     1-0277-003chr11:
CTexonicDe novononsynonymous SNVNM_133266c.G3427Ap.A1143T7.19-Wang2020 T
Yuen2017 G
Zhou2022 GE
SHANK2     PN400483chr11:
CTexonicUnknownunknown24.20.0049Leblond2019 E
SHANK2     GX0441.p1chr11:
CC/TexonicPaternal--Guo2018 T
SHANK2     AGRE_AU1644303chr11:
CTexonicUnknownunknown27.34.604E-5Wang2020 T
SHANK2     AGRE_AU1181303chr11:
CTexonicUnknownnonsynonymous SNVNM_133266c.G412Ap.D138N22.58.332E-6Wang2020 T
SHANK2     AGRE_03C16187chr11:
CTexonicUnknownnonsynonymous SNVNM_133266c.G415Ap.D139N18.898.389E-6Wang2020 T
SHANK2     1-0104-003chr11:
ATAAAGGGTAintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     M32019chr11:
CC/TexonicPaternal--Guo2018 T
SHANK2     ACGC_HEN0059.p1chr11:
CTCexonicUnknownframeshift deletionNM_133266c.1946delAp.E649fs--Wang2020 T
SHANK2     GX0409.p1chr11:
TCexonicPaternalnonsynonymous SNVNM_133266c.A4Gp.M2V15.77-Guo2018 T
SHANK2     ACGC_GX0546.p1chr11:
CTCexonicUnknownframeshift deletionNM_133266c.1946delAp.E649fs--Wang2020 T
SHANK2     M30889chr11:
GA/GexonicPaternal--Guo2018 T
SHANK2     Leuven2_82947565chr11:
CGexonicUnknownnonsynonymous SNVNM_133266c.G635Cp.R212P29.82.538E-5Wang2020 T
SHANK2     GX0233.p1chr11:
GA/GexonicPaternal--Guo2018 T
SHANK2     ACGC_HEN0078.p1chr11:
CTCexonicUnknownframeshift deletionNM_133266c.1946delAp.E649fs--Wang2020 T
SHANK2     ACGC_HEN0243.p1chr11:
GAexonicUnknownsynonymous SNVNM_133266c.C2301Tp.T767T-1.651E-5Wang2020 T
SHANK2     Leuven_393327chr11:
GAexonicUnknownunknown-3.0E-4Wang2020 T
SHANK2     ACGC_M32301chr11:
CTexonicUnknownunknown15.31-Wang2020 T
SHANK2     AGRE_AU0906301chr11:
CTexonicUnknownnonsynonymous SNVNM_133266c.G280Ap.G94R26.28.253E-6Wang2020 T
SHANK2     ACGC_HEN0333.p1chr11:
GAexonicUnknownsynonymous SNVNM_133266c.C1782Tp.P594P-1.72E-5Wang2020 T
SHANK2     AU027506 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
SHANK2     ACGC_M31992chr11:
CTexonicUnknownunknown15.31-Wang2020 T
SHANK2     3-0458-000Achr11:
TCintergenicDe novo--Yuen2017 G
SHANK2     AU066403chr11:
GAintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     SP0160736chr11:
GTexonicstopgainNM_133266c.C2585Ap.S862X39.0-Zhou2022 GE
SHANK2     SP0198200chr11:
ATexonicDe novononsynonymous SNVNM_133266c.T2451Ap.F817L10.31-Trost2022 G
Zhou2022 GE
SHANK2     SP0198200chr11:
TATexonicDe novoframeshift deletionNM_133266c.2457delTp.F819fs--Trost2022 G
Zhou2022 GE
SHANK2     5-5185-003chr11:
GTintronicDe novo--Trost2022 G
SHANK2     3-0475-000chr11:
CTintronicDe novo--Trost2022 G
SHANK2     2-1751-003chr11:
CTintronicDe novo--Trost2022 G
SHANK2     PN400267chr11:
ATexonicUnknownunknown18.290.0046Leblond2019 E
SHANK2     2-1781-003chr11:
CTintronicDe novo--Trost2022 G
SHANK2     MSSNG00219-003chr11:
CTintronicDe novo--Trost2022 G
SHANK2     SP0264333chr11:
CTCexonicframeshift deletionNM_133266c.998delAp.K333fs--Zhou2022 GE
SHANK2     4-0026-003chr11:
CTintronicDe novo--Trost2022 G
SHANK2     5-2005-003chr11:
CTATCTGCUTR3De novo--Trost2022 G
SHANK2     SP0055686chr11:
GAintronicDe novo--Trost2022 G
SHANK2     ACGC_HEN0344.p1chr11:
GAexonicMaternalunknown21.0-Wang2020 T
SHANK2     7-0385-003chr11:
CTintronicDe novo--Trost2022 G
SHANK2     ACGC_HEN0141.p1chr11:
CTexonicMaternalunknown29.54.993E-5Wang2020 T
SHANK2     MSSNG00369-005chr11:
GTintronicDe novo--Trost2022 G
SHANK2     5-0067-003chr11:
CTintronicDe novo--Trost2022 G
SHANK2     ACGC_M17580chr11:
GAexonicMaternalunknown20.2-Wang2020 T
SHANK2     1-0562-003chr11:
GAintronicDe novo--Trost2022 G
SHANK2     GX0379.p1chr11:
CTexonicUnknownnonsynonymous SNVNM_133266c.G2105Ap.R702Q9.6164.121E-5Guo2018 T
SHANK2     MSSNG00013-004chr11:
GTintronicDe novo--Trost2022 G
SHANK2     AU3801301chr11:
CTintronicDe novo--Yuen2017 G
SHANK2     1-1126-003chr11:
CAintronicDe novo--Trost2022 G
SHANK2     3-0431-000chr11:
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
SHANK2     ITAN_2428chr11:
GAexonicMaternalunknown17.81-Wang2020 T
SHANK2     7-0352-003chr11:
GTintronicDe novo--Trost2022 G
SHANK2     ITAN_1435chr11:
CTexonicMaternalunknown32.0-Wang2020 T
SHANK2     MSSNG00199-003chr11:
TCintronicDe novo--Trost2022 G
SHANK2     SJD_55.3chr11:
TCintronicDe novo--Trost2022 G
SHANK2     2-1398-004chr11:
AGCAGGCTGTGAintronicDe novo--Trost2022 G
SHANK2     MT_81.3chr11:
TCintronicDe novo--Trost2022 G
SHANK2     10C108736chr11:
GAexonicDe novostopgainNM_133266c.C757Tp.R253X24.1-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SHANK2     3-0713-000chr11:
CTintronicDe novo--Trost2022 G
SHANK2     AU059003chr11:
GAintronicDe novo--Trost2022 G
SHANK2     AU2437302chr11:
TAintronicDe novo--Trost2022 G
SHANK2     MSSNG00243-003chr11:
ACintronicDe novo--Trost2022 G
SHANK2     3-0050-000chr11:
GAintronicDe novo--Trost2022 G
SHANK2     5-5015-003chr11:
ACintronicDe novo--Trost2022 G
SHANK2     2-0310-003chr11:
GAintergenicDe novo--Yuen2017 G
SHANK2     AU2308301chr11:
GAintronicDe novo--Trost2022 G
SHANK2     MSSNG00011-004chr11:
TCintronicDe novo--Trost2022 G
SHANK2     3-0066-001chr11:
GAintronicDe novo--Trost2022 G
SHANK2     2-1237-004chr11:
CTintronicDe novo--Trost2022 G
SHANK2     3-0731-001Achr11:
CTintronicDe novo--Trost2022 G
SHANK2     2-0198-004chr11:
GAintergenicDe novo--Yuen2017 G
SHANK2     MSSNG00364-003chr11:
CTintronicDe novo--Trost2022 G
SHANK2     1-0700-004chr11:
CGintronicDe novo--Trost2022 G
SHANK2     AU071203chr11:
GAintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     1-0481-003chr11:
TGGGATCGAGAAACTintronicDe novo--Trost2022 G
SHANK2     1-0051-004chr11:
TGGGATCGAGAAACTintronicDe novo--Trost2022 G
SHANK2     2-1360-003chr11:
CAintronicDe novo--Trost2022 G
SHANK2     PN400486chr11:
CTexonicUnknownunknown24.20.0049Leblond2019 E
SHANK2     1-0481-003chr11:
TTCintronicDe novo--Trost2022 G
SHANK2     1-0464-003chr11:
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
SHANK2     7-0395-003chr11:
GAintronicDe novo--Trost2022 G
SHANK2     10-1127-003Achr11:
GAintronicDe novo--Trost2022 G
SHANK2     7-0233-004chr11:
GCintronicDe novo--Trost2022 G
SHANK2     3-0191-000chr11:
GCintronicDe novo--Trost2022 G
SHANK2     5-5131-003chr11:
CGintronicDe novo--Trost2022 G
SHANK2     5-5027-003chr11:
TATintronicDe novo--Trost2022 G
SHANK2     1-0440-003chr11:
TAintronicDe novo--Trost2022 G
SHANK2     1-0362-003chr11:
GAintronicDe novo--Trost2022 G
SHANK2     PN400380chr11:
CTexonicUnknownunknown24.20.0049Leblond2019 E
SHANK2     1-0481-003chr11:
TCTGintronicDe novo--Trost2022 G
SHANK2     1-0051-004chr11:
TCTGintronicDe novo--Trost2022 G
SHANK2     2-1644-003chr11:
TGGGATCGAGAAACTintronicDe novo--Trost2022 G
SHANK2     2-1644-003chr11:
TCTGintronicDe novo--Trost2022 G
SHANK2     MT_70.3chr11:
CCTAintronicDe novo--Trost2022 G
SHANK2     171-08-109761chr11:
GTexonicDe novostopgainNM_133266c.C2585Ap.S862X39.0-Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SHANK2     MSSNG00343-003chr11:
GAintronicDe novo--Trost2022 G
SHANK2     4-0090-003chr11:
CTintronicDe novo--Trost2022 G
SHANK2     MSSNG00340-004chr11:
CTintronicDe novo--Trost2022 G
SHANK2     MSSNG00364-004chr11:
GAintronicDe novo--Trost2022 G
SHANK2     2-1459-003chr11:
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
SHANK2     ITAN_2176chr11:
GAexonicMaternalsynonymous SNVNM_133266c.C414Tp.D138D3.697-Wang2020 T
SHANK2     HN0112.p1chr11:
GCexonicDe novostopgainNM_133266c.C87Gp.Y29X37.0-Guo2018 T
SHANK2     3-0458-000Bchr11:
TCintergenicDe novo--Yuen2017 G
SHANK2     AU4433301chr11:
ACintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     HEN0141.p1chr11:
CTexonicMaternalunknown29.54.993E-5Guo2018 T
SHANK2     1-0441-003chr11:
GAexonicDe novostopgainNM_133266c.C757Tp.R253X24.1-Wang2020 T
Yuen2016 G
Yuen2017 G
Zhou2022 GE
SHANK2     AU4336301chr11:
GAintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     M15036chr11:
GAexonicInheritedsynonymous SNVNM_133266c.C2082Tp.Y694Y-3.298E-5Stessman2017 T
SHANK2     M08903chr11:
TCexonicPaternalnonsynonymous SNVNM_133266c.A2212Gp.N738D0.0018.24E-6Guo2018 T
SHANK2     M19792chr11:
CTexonicPaternalnonsynonymous SNVNM_133266c.G2305Ap.G769S12.692.477E-5Guo2018 T
SHANK2     HEN0344.p1chr11:
GAexonicMaternalunknown21.0-Guo2018 T
SHANK2     HEN0080.p1chr11:
CTexonicMaternalunknown11.14-Guo2018 T
SHANK2     HEN0031.p1chr11:
GAexonicMaternalunknown15.74.813E-5Guo2018 T
SHANK2     HEN0214.p1chr11:
CTexonicMaternalunknown13.984.529E-5Guo2018 T
SHANK2     M08656chr11:
AA/GexonicPaternal--Guo2018 T
SHANK2     SF0136425.p1chr11:
CTsplicingsplicing17.85-Wang2020 T
SHANK2     M20665chr11:
CTexonicPaternalunknown14.33-Guo2018 T
SHANK2     M08500chr11:
GAexonicPaternalunknown13.171.0E-4Guo2018 T
SHANK2     1-0019-004chr11:
CTintronicDe novo--Yuen2017 G
SHANK2     M08440chr11:
AA/GexonicPaternal--Guo2018 T
SHANK2     M23785chr11:
CTexonicPaternalnonsynonymous SNVNM_133266c.G1456Ap.V486I11.883.471E-5Guo2018 T
SHANK2     M01813chr11:
CGexonicPaternalnonsynonymous SNVNM_133266c.G1995Cp.M665I12.178.25E-6Guo2018 T
SHANK2     M15191chr11:
CTexonicPaternalunknown16.13-Guo2018 T
SHANK2     M17534chr11:
AGexonicPaternalnonsynonymous SNVNM_133266c.T67Cp.C23R13.26-Guo2018 T
SHANK2     AU2019302chr11:
GAintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     M17580chr11:
GAexonicMaternal, Unknownunknown20.2-Guo2018 T
Stessman2017 T
SHANK2     ACGC_M30889chr11:
GAexonicPaternalunknown21.11.0E-4Wang2020 T
SHANK2     SP0062760chr11:
CTexonicDe novosynonymous SNVNM_133266c.G48Ap.T16T10.844.119E-5Fu2022 E
Trost2022 G
Zhou2022 GE
SHANK2     ACGC_M15191chr11:
CTexonicPaternalunknown16.13-Wang2020 T
SHANK2     SP0136425chr11:
CTsplicingDe novosplicing17.85-Fu2022 E
Trost2022 G
Zhou2022 GE
SHANK2     SP0048613chr11:
AAGTACATCCCCTTCTCCCTCATCATGGTGexonicDe novoframeshift insertionNM_133266c.1089_1090insCACCATGATGAGGGAGAAGGGGATGTACp.F364fs--Fu2022 E
Zhou2022 GE
SHANK2     2-0198-005chr11:
GAintergenicDe novo--Yuen2017 G
SHANK2     M21695chr11:
CAexonicInherited, Paternalnonsynonymous SNVNM_133266c.G1524Tp.R508S15.87-Guo2018 T
Stessman2017 T
SHANK2     14015.p1chr11:
TGintronicDe novo--Turner2016 G
SHANK2     PN400514chr11:
CTexonicUnknownunknown24.20.0049Leblond2019 E
SHANK2     Radboud_10-10578chr11:
CTexonicPaternalunknown20.35.012E-5Wang2020 T
SHANK2     10004871007410237-Cchr11:
TCTexonicDe novounknown--Fu2022 E
SHANK2     AU3632301chr11:
CTintronicDe novo--Yuen2017 G
SHANK2     Radboud_10-10576chr11:
CTexonicPaternalunknown20.35.012E-5Wang2020 T
SHANK2     PN400279chr11:
CTexonicUnknownunknown24.20.0049Leblond2019 E
SHANK2     ACGC_HEN0004.p1chr11:
GAexonicUnknownsynonymous SNVNM_133266c.C2088Tp.T696T-8.243E-6Wang2020 T
SHANK2     AU1940304 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
SHANK2     08C74824chr11:
GAexonicDe novounknown14.44-Fu2022 E
SHANK2     GEA430chr11:
CCGintronicDe novo-9.076E-5Fu2022 E
SHANK2     HEN0361.p1chr11:
CTexonicPaternalnonsynonymous SNVNM_133266c.G2057Ap.R686K12.853.301E-5Guo2018 T
SHANK2     TASC_219-2325-0001chr11:
GAexonicUnknownnonsynonymous SNVNM_133266c.C620Tp.A207V20.68.396E-6Wang2020 T
SHANK2     3-0458-000chr11:
TCintergenicDe novo--Yuen2016 G
SHANK2     HEN0171.p1chr11:
CTexonicUnknownunknown20.2-Guo2018 T
SHANK2     PN400515chr11:
CTexonicUnknownunknown24.20.0049Leblond2019 E
SHANK2     AU3951301chr11:
GAintronicDe novo--Yuen2017 G
SHANK2     2-1508-003chr11:
CTintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     M32289chr11:
CTexonicMaternalunknown33.04.741E-5Guo2018 T
SHANK2     Ishay2021:30chr11:
TCTexonicDe novounknown--Ishay2021 E
SHANK2     AU2513301chr11:
GAexonicunknown14.44-Zhou2022 GE
SHANK2     AU4467302chr11:
CTintergenicDe novo--Yuen2017 G
SHANK2     SP0052138chr11:
CTexonicDe novosynonymous SNVNM_133266c.G3510Ap.A1170A-2.0E-4Trost2022 G
Zhou2022 GE
SHANK2     03C16187chr11:
CTexonicUnknownnonsynonymous SNVNM_133266c.G415Ap.D139N18.898.389E-6Stessman2017 T
SHANK2     08C74281chr11:
CTexonicDe novononsynonymous SNVNM_133266c.G3427Ap.A1143T7.19-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SHANK2     03C16378chr11:
CTexonicUnknownunknown24.64.601E-5Stessman2017 T
SHANK2     PN400317chr11:
ATexonicUnknownunknown18.290.0046Leblond2019 E
SHANK2     AU3905301chr11:
CTintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     1-0273-004chr11:
CTintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     2-0145-004chr11:
CTintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     1-0936-003chr11:
GAintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     PN400321chr11:
ATexonicUnknownunknown18.290.0046Leblond2019 E
SHANK2     2-0214-004chr11:
ATintergenicDe novo--Yuen2017 G
SHANK2     Leuven2_60356116chr11:
CTexonicUnknownunknown31.0-Wang2020 T
SHANK2     AU3124302chr11:
GAintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     Leuven_85885770chr11:
CTexonicUnknownunknown31.0-Wang2020 T
SHANK2     SAGE_BK831-01chr11:
GAexonicUnknownunknown26.7-Wang2020 T
SHANK2     AU2100302chr11:
GAintronicDe novo--Trost2022 G
Yuen2017 G
SHANK2     GX0432.p1chr11:
AA/CexonicMaternal--Guo2018 T
SHANK2     ACGC_M21695chr11:
CAexonicUnknownnonsynonymous SNVNM_133266c.G1524Tp.R508S15.87-Wang2020 T
SHANK2     Leuven_300450chr11:
CTexonicUnknownunknown27.1-Wang2020 T
SHANK2     GX0430.p1chr11:
GC/GexonicMaternal--Guo2018 T
SHANK2     GX0444.p1chr11:
GCexonicMaternalnonsynonymous SNVNM_133266c.C1925Gp.S642C9.744-Guo2018 T
SHANK2     GX0240.p1chr11:
GA/GexonicMaternal--Guo2018 T
SHANK2     GX0358.p1chr11:
GC/GexonicMaternal--Guo2018 T
SHANK2     mAGRE5936chr11:
CTintronicPaternal17.45-Cirnigliaro2023 G
SHANK2     mAGRE5935chr11:
CTintronicPaternal17.45-Cirnigliaro2023 G
SHANK2     219-2325-0001chr11:
GAexonicUnknownnonsynonymous SNVNM_133266c.C620Tp.A207V20.68.396E-6Stessman2017 T
SHANK2     2-1303-003chr11:
CTintronicDe novo--Yuen2017 G
SHANK2     1-0197-004chr11:
CTintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView