or
or
Exact

Results for "SLC6A1"

Variant Events: 51

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SLC6A1     211-5563-3chr3:
11067982-11067982
TCexonicDe novononsynonymous SNVNM_003042c.T1015Cp.F339L34.0-O’Roak2014 T
SLC6A1     ZH50743chr3:
11060364-11060365
CTCexonicDe novoframeshift deletionNM_003042c.452delTp.L151fs--O’Roak2014 T
SLC6A1     AGRE_AU038204chr3:
11067143-11067143
CAexonicDe novostopgainNM_003042c.C723Ap.Y241X37.0-Wang2020 T
SLC6A1     AGRE_03C16890chr3:
11067143-11067143
CAexonicDe novostopgainNM_003042c.C723Ap.Y241X37.0-Wang2020 T
SLC6A1     AU008505chr3:
11112036-11112036
GCintergenicDe novo--Yuen2017 G
SLC6A1     2-1567-004chr3:
11081722-11081722
GTdownstreamDe novo--Yuen2017 G
SLC6A1     2-1155-003chr3:
11067982-11067982
TCexonicDe novononsynonymous SNVNM_003042c.T1015Cp.F339L34.0-Trost2022 G
Wang2020 T
Yuen2016 G
Yuen2017 G
Zhou2022 GE
SLC6A1     SP0062483chr3:
11064070-11064089
CCGCTGGCCACTGGCCATCACexonicDe novoframeshift deletionNM_003042c.631_649delp.R211fs--Antaki2022 GE
Fu2022 E
Zhou2022 GE
SLC6A1     MT_178.4chr3:
11069756-11069756
GAintronicDe novo--Trost2022 G
SLC6A1     TAS_F4013Ychr3:
11064033-11064033
ACexonicDe novononsynonymous SNVNM_003042c.A593Cp.H198P24.7-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SLC6A1     AU3861302chr3:
11040192-11040192
GAintronicDe novo--Trost2022 G
Yuen2017 G
SLC6A1     SP0289806chr3:
11078547-11078547
GAsplicingsplicing17.5-Zhou2022 GE
SLC6A1     SP0165699chr3:
11072886-11072888
CTTCexonicframeshift deletionNM_003042c.1348_1349delp.F450fs--Zhou2022 GE
SLC6A1     SP0168055chr3:
11059120-11059120
GCexonicDe novononsynonymous SNVNM_003042c.G223Cp.G75R17.74-Trost2022 G
Zhou2022 GE
SLC6A1     SP0355487chr3:
11070971-11070971
GAexonicnonsynonymous SNVNM_003042c.G1256Ap.R419H24.5-Zhou2022 GE
SLC6A1     SP0205964chr3:
11067472-11067472
CTexonicnonsynonymous SNVNM_003042c.C863Tp.A288V29.7-Zhou2022 GE
SLC6A1     1-0186-005chr3:
11172207-11172207
CGintergenicDe novo--Yuen2017 G
SLC6A1     2-1335-004chr3:
11118394-11118394
GTintergenicDe novo--Yuen2017 G
SLC6A1     13832.p1chr3:
11067472-11067472
CTexonicDe novononsynonymous SNVNM_003042c.C863Tp.A288V29.7-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Zhou2022 GE
SLC6A1     13734.p1chr3:
11067505-11067505
GTexonicDe novo, Unknownnonsynonymous SNVNM_003042c.G896Tp.G299V24.3-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Wang2020 T
Zhou2022 GE
SLC6A1     Chen2021:51chr3:
11064155-11064155
GAsplicingDe novosplicing21.2-Chen2021 GET
SLC6A1     14340.p1chr3:
11076337-11076337
GAexonicDe novononsynonymous SNVNM_003042c.G1648Ap.G550R15.95-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Zhou2022 GE
SLC6A1     Chen2021:50chr3:
11067962-11067962
TGexonicDe novononsynonymous SNVNM_003042c.T995Gp.M332R24.3-Chen2021 GET
SLC6A1     SSC10931chr3:
11076337-11076337
GAexonicDe novononsynonymous SNVNM_003042c.G1648Ap.G550R15.95-Fu2022 E
Lim2017 E
Trost2022 G
SLC6A1     SSC09465chr3:
11067472-11067472
CTexonicDe novononsynonymous SNVNM_003042c.C863Tp.A288V29.7-Fu2022 E
Lim2017 E
Trost2022 G
SLC6A1     Leuven_46361chr3:
11070944-11070944
AGexonicUnknownnonsynonymous SNVNM_003042c.A1229Gp.D410G28.3-Wang2020 T
SLC6A1     ITAN_469chr3:
11064023-11064023
CTexonicPaternalnonsynonymous SNVNM_003042c.C583Tp.R195C31.08.415E-6Wang2020 T
SLC6A1     03C16890chr3:
11067143-11067143
CAexonicDe novostopgainNM_003042c.C723Ap.Y241X37.0-Stessman2017 T
SLC6A1     ACGC_M23713chr3:
11075334-11075334
GAexonicUnknownnonsynonymous SNVNM_003042c.G1436Ap.R479Q25.36.685E-5Wang2020 T
SLC6A1     AU038204chr3:
11067143-11067143
CAexonicDe novostopgainNM_003042c.C723Ap.Y241X37.0-Stessman2017 T
Stessman2017 T
Wang2020 T
Yuen2017 G
Zhou2022 GE
SLC6A1     ACGC_M30580chr3:
11070520-11070520
GTexonicUnknownnonsynonymous SNVNM_003042c.G1178Tp.G393V25.1-Wang2020 T
SLC6A1     ACGC_SD0314.p1chr3:
11067522-11067522
GAexonicUnknownnonsynonymous SNVNM_003042c.G913Ap.A305T24.3-Wang2020 T
SLC6A1     NDAR_INVUD365NYJ_wes1chr3:
11068045-11068045
GAexonicDe novo, Unknownnonsynonymous SNVNM_003042c.G1078Ap.G360S35.0-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Wang2020 T
Zhou2022 GE
SLC6A1     ACGC_GX0579.p1chr3:
11076248-11076248
CTexonicUnknownnonsynonymous SNVNM_003042c.C1559Tp.T520M23.32.478E-5Wang2020 T
SLC6A1     TAS_F0207Xchr3:
11067528-11067528
GAexonicDe novononsynonymous SNVNM_003042c.G919Ap.G307R24.5-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SLC6A1     Leuven_413832chr3:
11076248-11076248
CTexonicUnknownnonsynonymous SNVNM_003042c.C1559Tp.T520M23.32.478E-5Wang2020 T
SLC6A1     111767chr3:
11059079-11059079
CGexonicDe novononsynonymous SNVNM_003042c.C182Gp.A61G31.0-Fu2022 E
SLC6A1     13734_p1chr3:
11067505-11067505
GTexonicDe novononsynonymous SNVNM_003042c.G896Tp.G299V24.3-Fu2022 E
SLC6A1     3-0723-000chr3:
11059607-11059607
AGexonicDe novononsynonymous SNVNM_003042c.A317Gp.Q106R25.1-Trost2022 G
Zhou2022 GE
SLC6A1     22231.p1chr3:
11059076-11059076
AGexonicnonsynonymous SNVNM_003042c.A179Gp.Y60C20.3-Zhou2022 GE
SLC6A1     ASC_4E252chr3:
11059057-11059057
CTexonicDe novononsynonymous SNVNM_003042c.C160Tp.L54F27.1-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SLC6A1     MSSNG00411-003chr3:
11067181-11067181
TCexonicDe novononsynonymous SNVNM_003042c.T761Cp.L254P23.0-Trost2022 G
Zhou2022 GE
SLC6A1     Uddin2014:7chr3:
11067472-11067472
CTexonicDe novononsynonymous SNVNM_003042c.C863Tp.A288V29.7-Uddin2014 E
SLC6A1     AU038203chr3:
11067143-11067143
CAexonicDe novostopgainNM_003042c.C723Ap.Y241X37.0-Wang2020 T
Yuen2017 G
Zhou2022 GE
SLC6A1     SanDiego_00560-N3L9Achr3:
11067240-11067240
CTexonicUnknownnonsynonymous SNVNM_003042c.C820Tp.P274S27.2-Wang2020 T
SLC6A1     P0095chr3:
11067962-11067962
TGexonicDe novononsynonymous SNVNM_003042c.T995Gp.M332R24.3-Xiong2019 ET
SLC6A1     242-08-110053chr3:
11067472-11067472
CTexonicDe novononsynonymous SNVNM_003042c.C863Tp.A288V29.7-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SLC6A1     M0329chr3:
11064155-11064155
GAsplicingDe novosplicing21.2-Xiong2019 ET
SLC6A1     413832chr3:
11076248-11076248
CTexonicUnknownnonsynonymous SNVNM_003042c.C1559Tp.T520M23.32.478E-5Stessman2017 T
SLC6A1     46361chr3:
11070944-11070944
AGexonicUnknownnonsynonymous SNVNM_003042c.A1229Gp.D410G28.3-Stessman2017 T
SLC6A1     Miyake2023:19052chr3:
11059051-11059051
GTexonicDe novononsynonymous SNVNM_003042c.G154Tp.D52Y26.3-Miyake2023 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More