or
or
Exact

Results for "KMT5B"

Variant Events: 62

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KMT5B     7-0309-003chr11:
67951420-67951420
CGintronicDe novo--Trost2022 G
KMT5B     Mahjani2021:25chr11:
67934472-67934472
GGTexonicframeshift insertionNM_001300909
NM_001300908
NM_016028
NM_017635
NM_001300907
c.1081dupA
c.430dupA
c.1150dupA
c.1150dupA
c.634dupA
p.T361fs
p.T144fs
p.T384fs
p.T384fs
p.T212fs
--Mahjani2021 E
KMT5B     ACGC_SD0199.p1chr11:
67942510-67942510
AGexonicUnknownnonsynonymous SNVNM_001300909
NM_016028
NM_017635
NM_001300907
c.T449C
c.T518C
c.T518C
c.T2C
p.M150T
p.M173T
p.M173T
p.M1T
13.05-Wang2020 T
KMT5B     REACH000163chr11:
67955620-67955620
TCintronicDe novo--Trost2022 G
KMT5B     3-0648-000chr11:
67951315-67951315
TCintronicDe novo--Trost2022 G
KMT5B     ACGC_M15194chr11:
67938486-67938486
CTexonicUnknownnonsynonymous SNVNM_001300909
NM_001300908
NM_016028
NM_017635
NM_001300907
c.G904A
c.G253A
c.G973A
c.G973A
c.G457A
p.E302K
p.E85K
p.E325K
p.E325K
p.E153K
24.3-Wang2020 T
KMT5B     Leuven2_60407442chr11:
67925243-67925243
CTexonicUnknownnonsynonymous SNVNM_001300908
NM_017635
NM_001300907
c.G1850A
c.G2570A
c.G2054A
p.R617H
p.R857H
p.R685H
25.0-Wang2020 T
KMT5B     ACGC_GX0295.p1chr11:
67934646-67934646
CTsplicingUnknownsplicing21.5-Wang2020 T
KMT5B     TASC_215-13198-2154chr11:
67938521-67938521
CTexonicUnknownnonsynonymous SNVNM_001300909
NM_001300908
NM_016028
NM_017635
NM_001300907
c.G869A
c.G218A
c.G938A
c.G938A
c.G422A
p.G290E
p.G73E
p.G313E
p.G313E
p.G141E
31.0-Wang2020 T
KMT5B     iHART2899chr11:
67947668-67947672
CTATACsplicingMaternalsplicing-3.0E-4Ruzzo2019 G
KMT5B     iHART2900chr11:
67947668-67947672
CTATACsplicingMaternalsplicing-3.0E-4Ruzzo2019 G
KMT5B     Mahjani2021:32chr11:
67947635-67947636
GAGexonicframeshift deletionNM_016028
NM_017635
c.340delT
c.340delT
p.S114fs
p.S114fs
--Mahjani2021 E
KMT5B     80001100623chr11:
67947635-67947636
GAGexonicDe novoframeshift deletionNM_016028
NM_017635
c.340delT
c.340delT
p.S114fs
p.S114fs
--Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KMT5B     REACH000349chr11:
67974537-67974537
GAintronicDe novo--Trost2022 G
KMT5B     iHART2902chr11:
67947668-67947672
CTATACsplicingMaternalsplicing-3.0E-4Ruzzo2019 G
KMT5B     AU000704chr11:
67926064-67926140
AGGAGCTGGCTGCAGCTGTTCACCACTGTCGGGGCAAGGTTCCGTCACACTGCTTTTATAGCCATTCAACGTATTTGAexonicDe novoframeshift deletionNM_001300908
NM_017635
NM_001300907
c.953_1028del
c.1673_1748del
c.1157_1232del
p.P318fs
p.P558fs
p.P386fs
--Wang2020 T
KMT5B     5-5217-003chr11:
67967075-67967075
ACintronicDe novo--Trost2022 G
KMT5B     5-0134-003chr11:
67974434-67974435
GCGintronicDe novo--Trost2022 G
KMT5B     3-0089-000chr11:
67926274-67926274
CTexonicDe novosynonymous SNVNM_001300908
NM_017635
NM_001300907
c.G819A
c.G1539A
c.G1023A
p.A273A
p.A513A
p.A341A
--Trost2022 G
Zhou2022 GE
KMT5B     1-0028-003chr11:
68019929-68019929
CTintergenicDe novo--Yuen2017 G
KMT5B     11729.p1chr11:
67926275-67926275
GAexonicDe novononsynonymous SNVNM_001300908
NM_017635
NM_001300907
c.C818T
c.C1538T
c.C1022T
p.A273V
p.A513V
p.A341V
20.51.65E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Sanders2012 E
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Zhou2022 GE
KMT5B     11519.p1chr11:
67939039-67939039
CGexonicDe novo, Unknownnonsynonymous SNVNM_001300909
NM_001300908
NM_016028
NM_017635
NM_001300907
c.G722C
c.G71C
c.G791C
c.G791C
c.G275C
p.W241S
p.W24S
p.W264S
p.W264S
p.W92S
26.2-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Sanders2012 E
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Zhou2022 GE
KMT5B     12859.p1chr11:
67933707-67933707
GAUTR3De novo--Wilfert2021 G
KMT5B     1-0277-003chr11:
67988775-67988775
CAintergenicDe novo--Yuen2017 G
KMT5B     GX0295.p1chr11:
67934646-67934646
CTsplicingMaternalsplicing21.5-Guo2018 T
KMT5B     1507001chr11:
67942568-67942569
AGAexonicDe novoframeshift deletionNM_001300909
NM_016028
NM_017635
c.390delC
c.459delC
c.459delC
p.A130fs
p.A153fs
p.A153fs
--Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KMT5B     SF0056918.p1chr11:
67939048-67939050
GCAGexonicframeshift deletionNM_001300909
NM_001300908
NM_016028
NM_017635
NM_001300907
c.711_712del
c.60_61del
c.780_781del
c.780_781del
c.264_265del
p.C237fs
p.C20fs
p.C260fs
p.C260fs
p.C88fs
--Wang2020 T
KMT5B     SF0021872.p1chr11:
67926017-67926018
TCTexonicframeshift deletionNM_001300908
NM_017635
NM_001300907
c.1075delG
c.1795delG
c.1279delG
p.E359fs
p.E599fs
p.E427fs
--Wang2020 T
KMT5B     Leuven_181684chr11:
67957456-67957457
ATAexonicUnknownframeshift deletionNM_001300909
NM_016028
NM_017635
c.87delA
c.87delA
c.87delA
p.Q29fs
p.Q29fs
p.Q29fs
--Wang2020 T
KMT5B     AU3912301chr11:
67993363-67993363
GAintergenicDe novo--Yuen2017 G
KMT5B     80001100876chr11:
67934472-67934472
GGTexonicDe novoframeshift insertionNM_001300909
NM_001300908
NM_016028
NM_017635
NM_001300907
c.1081dupA
c.430dupA
c.1150dupA
c.1150dupA
c.634dupA
p.T361fs
p.T144fs
p.T384fs
p.T384fs
p.T212fs
--Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KMT5B     SF0028441.p1chr11:
67953320-67953322
TCATexonicframeshift deletionNM_001300909
NM_016028
NM_017635
c.234_235del
c.234_235del
c.234_235del
p.C78fs
p.C78fs
p.C78fs
--Wang2020 T
KMT5B     SF0091976.p1chr11:
67942484-67942484
CTsplicingsplicing23.5-Wang2020 T
KMT5B     12864.p1chr11:
67938481-67938481
CTsplicingDe novo, Unknownsplicing16.07-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lowther2023 G
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Willsey2013 E
Zhou2022 GE
KMT5B     GX0447.p1chr11:
67926606-67926606
TTTTTTACGCexonicPaternalstopgainNM_001300908
NM_017635
NM_001300907
c.486_487insGCGTAAAA
c.1206_1207insGCGTAAAA
c.690_691insGCGTAAAA
p.K163_N164delinsAX
p.K403_N404delinsAX
p.K231_N232delinsAX
--Guo2018 T
KMT5B     SF0051947.p1chr11:
67953320-67953322
TCATexonicframeshift deletionNM_001300909
NM_016028
NM_017635
c.234_235del
c.234_235del
c.234_235del
p.C78fs
p.C78fs
p.C78fs
--Wang2020 T
KMT5B     SP0275131chr11:
67953336-67953336
CTexonicnonsynonymous SNVNM_001300909
NM_016028
NM_017635
c.G220A
c.G220A
c.G220A
p.A74T
p.A74T
p.A74T
33.0-Zhou2022 GE
KMT5B     SP0207050chr11:
67942486-67942487
TGTexonicDe novoframeshift deletionNM_001300909
NM_016028
NM_017635
NM_001300907
c.472delC
c.541delC
c.541delC
c.25delC
p.H158fs
p.H181fs
p.H181fs
p.H9fs
--Trost2022 G
Zhou2022 GE
KMT5B     SP0238186chr11:
67925970-67925970
GAexonicstopgainNM_001300908
NM_017635
NM_001300907
c.C1123T
c.C1843T
c.C1327T
p.R375X
p.R615X
p.R443X
40.0-Zhou2022 GE
KMT5B     13964.p1chr11:
67921467-67921467
CTdownstreamDe novo--Turner2016 G
KMT5B     11519.p1chr11:
67938481-67938481
CTsplicingDe novosplicing16.07-Willsey2013 E
KMT5B     2-1549-003chr11:
68007313-68007313
CTintergenicDe novo--Yuen2017 G
KMT5B     2-0028-003chr11:
68008650-68008650
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
KMT5B     SSC03766chr11:
67926275-67926275
GAexonicDe novononsynonymous SNVNM_001300908
NM_017635
NM_001300907
c.C818T
c.C1538T
c.C1022T
p.A273V
p.A513V
p.A341V
20.51.65E-5Fu2022 E
Trost2022 G
KMT5B     SP0021872chr11:
67926017-67926018
TCTexonicDe novoframeshift deletionNM_001300908
NM_017635
NM_001300907
c.1075delG
c.1795delG
c.1279delG
p.E359fs
p.E599fs
p.E427fs
--Fu2022 E
Trost2022 G
Zhou2022 GE
KMT5B     SP0091976chr11:
67942484-67942484
CTsplicingDe novosplicing23.5-Fu2022 E
Trost2022 G
Zhou2022 GE
KMT5B     NDAR_INVNE346GDX_wes1chr11:
67925466-67925466
GAexonicDe novo, UnknownstopgainNM_001300908
NM_017635
NM_001300907
c.C1627T
c.C2347T
c.C1831T
p.R543X
p.R783X
p.R611X
40.0-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Wang2020 T
Zhou2022 GE
KMT5B     SP0056918chr11:
67939048-67939050
GCAGexonicDe novoframeshift deletionNM_001300909
NM_001300908
NM_016028
NM_017635
NM_001300907
c.711_712del
c.60_61del
c.780_781del
c.780_781del
c.264_265del
p.C237fs
p.C20fs
p.C260fs
p.C260fs
p.C88fs
--Fu2022 E
Trost2022 G
Zhou2022 GE
KMT5B     DEASD_0109_001chr11:
67941366-67941370
CAAATCexonicDe novo, Unknownframeshift deletionNM_001300909
NM_016028
NM_017635
NM_001300907
c.485_488del
c.554_557del
c.554_557del
c.38_41del
p.Y162fs
p.Y185fs
p.Y185fs
p.Y13fs
-8.28E-6DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Wang2020 T
Zhou2022 GE
KMT5B     SSC02433chr11:
67939039-67939039
CGexonicDe novononsynonymous SNVNM_001300909
NM_001300908
NM_016028
NM_017635
NM_001300907
c.G722C
c.G71C
c.G791C
c.G791C
c.G275C
p.W241S
p.W24S
p.W264S
p.W264S
p.W92S
26.2-Antaki2022 GE
Fu2022 E
Lim2017 E
Trost2022 G
KMT5B     SSC06091chr11:
67938481-67938481
CTsplicingDe novosplicing16.07-Fu2022 E
Lim2017 E
Trost2022 G
KMT5B     mAGRE2902chr11:
67947668-67947672
CTATACsplicingMaternalsplicing-3.0E-4Cirnigliaro2023 G
KMT5B     SP0051947chr11:
67953320-67953322
TCATexonicDe novoframeshift deletionNM_001300909
NM_016028
NM_017635
c.234_235del
c.234_235del
c.234_235del
p.C78fs
p.C78fs
p.C78fs
--Fu2022 E
Trost2022 G
Zhou2022 GE
KMT5B     mAGRE2900chr11:
67947668-67947672
CTATACsplicingMaternalsplicing-3.0E-4Cirnigliaro2023 G
KMT5B     SP0028441chr11:
67953320-67953322
TCATexonicDe novoframeshift deletionNM_001300909
NM_016028
NM_017635
c.234_235del
c.234_235del
c.234_235del
p.C78fs
p.C78fs
p.C78fs
--Fu2022 E
Trost2022 G
Zhou2022 GE
KMT5B     mAGRE2899chr11:
67947668-67947672
CTATACsplicingMaternalsplicing-3.0E-4Cirnigliaro2023 G
KMT5B     SP0104241chr11:
67933526-67933526
GAUTR3De novo--Fu2022 E
Trost2022 G
KMT5B     1-0466-003chr11:
67925217-67925217
AGexonicDe novononsynonymous SNVNM_001300908
NM_017635
NM_001300907
c.T1876C
c.T2596C
c.T2080C
p.S626P
p.S866P
p.S694P
20.1-Trost2022 G
Wang2020 T
Yuen2017 G
Zhou2022 GE
KMT5B     SP0104743chr11:
67939112-67939115
TCTCTexonicDe novononframeshift deletionNM_001300909
NM_016028
NM_017635
NM_001300907
c.646_648del
c.715_717del
c.715_717del
c.199_201del
p.216_216del
p.239_239del
p.239_239del
p.67_67del
--Fu2022 E
Zhou2022 GE
KMT5B     Uddin2014:30chr11:
67938481-67938481
CTsplicingDe novosplicing16.07-Uddin2014 E
KMT5B     1-0272-004chr11:
67994280-67994280
TCintergenicDe novo--Yuen2017 G
KMT5B     SP0008212chr11:
67957379-67957379
CTintronicDe novo--Fu2022 E
Zhou2022 GE
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More