or
or
Exact

Results for "ARID1B"

Variant Events: 127

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ARID1B     4B705chr6:
157527706-157527706
GTexonicDe novostopgainNM_017519
NM_020732
c.G5392T
c.G5431T
p.E1798X
p.E1811X
42.0-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ARID1B     AU144Achr6:
157488271-157488271
CTexonicDe novostopgainNM_017519
NM_020732
c.C2938T
c.C2977T
p.Q980X
p.Q993X
38.0-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ARID1B     NDAR_INVPC670BF4_wes1chr6:
157488314-157488314
CAexonicDe novostopgainNM_017519
NM_020732
c.C2981A
c.C3020A
p.S994X
p.S1007X
38.0-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ARID1B     10C106241chr6:
157527390-157527390
CCGexonicDe novoframeshift insertionNM_017519
NM_020732
c.5076_5077insG
c.5115_5116insG
p.D1692fs
p.D1705fs
--DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ARID1B     1-0274-003chr6:
157397674-157397674
CCCTintronicDe novo--Trost2022 G
Yuen2017 G
ARID1B     DEASD_0171_001chr6:
157528178-157528178
AGexonicDe novononsynonymous SNVNM_017519
NM_020732
c.A5864G
c.A5903G
p.H1955R
p.H1968R
14.93-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ARID1B     1-0971-003chr6:
157250854-157250854
CAintronicDe novo--Trost2022 G
Yuen2017 G
ARID1B     09C90171chr6:
157522599-157522599
GAexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.G4832A
c.G4871A
p.R1611Q
p.R1624Q
18.981.878E-5Stessman2017 T
ARID1B     7-0223-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
ARID1B     AU075207chr6:
157271683-157271683
GAintronicDe novo--Trost2022 G
Yuen2017 G
ARID1B     14640.p1chr6:
157100567-157100568
AGAexonicDe novoframeshift deletionNM_017519
NM_020732
c.1505delG
c.1505delG
p.S502fs
p.S502fs
--Lowther2023 G
Turner2017 G
Wilfert2021 G
Zhou2022 GE
ARID1B     2-1466-003chr6:
157467784-157467798
GCACACACACACACAGCACACACACACAintronicDe novo--Yuen2017 G
ARID1B     AU4237302chr6:
157517450-157517450
GAsplicingMaternalsplicing25.6-Cirnigliaro2023 G
ARID1B     mAGRE1912chr6:
157454160-157454160
ACsplicingPaternalsplicing21.0-Cirnigliaro2023 G
ARID1B     mAGRE1910chr6:
157454160-157454160
ACsplicingPaternalsplicing21.0-Cirnigliaro2023 G
ARID1B     AU2458303chr6:
157633248-157633248
GAintergenicDe novo--Yuen2017 G
ARID1B     80001101245chr6:
157517445-157517445
CTexonicDe novostopgainNM_017519
NM_020732
c.C3970T
c.C4009T
p.R1324X
p.R1337X
43.0-Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ARID1B     AU060803chr6:
157228765-157228765
CTintronicDe novo--Yuen2017 G
ARID1B     M04133chr6:
157522160-157522161
AGAexonicUnknownframeshift deletionNM_017519
NM_020732
c.4394delG
c.4433delG
p.R1465fs
p.R1478fs
--Guo2018 T
Wang2016 T
ARID1B     AU053503chr6:
157521885-157521885
GTexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.G4118T
c.G4157T
p.R1373L
p.R1386L
18.25-Stessman2017 T
ARID1B     AU4067303chr6:
157426082-157426082
CGintronicDe novo--Trost2022 G
Yuen2017 G
ARID1B     SSC12582chr6:
157100567-157100568
AGAexonicframeshift deletionNM_017519
NM_020732
c.1505delG
c.1505delG
p.S502fs
p.S502fs
--Antaki2022 GE
ARID1B     1-0052-003chr6:
157539412-157539412
TTGTGCAGATGACAGGGCCAGCGTTGGGAGGGGCCintergenicDe novo--Yuen2017 G
ARID1B     160708chr6:
157406028-157406028
CTexonicDe novononsynonymous SNVNM_017519
NM_020732
c.C2231T
c.C2270T
p.A744V
p.A757V
31.0-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ARID1B     SSC07458chr6:
157527664-157527668
CTGTTCexonicframeshift deletionNM_017519
NM_020732
c.5351_5354del
c.5390_5393del
p.L1784fs
p.L1797fs
--Antaki2022 GE
ARID1B     AN16641chr6:
157522004-157522004
CTexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.C4237T
c.C4276T
p.P1413S
p.P1426S
13.33-D’Gama2015 T
ARID1B     AN17515chr6:
157100526-157100526
CGexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.C1463G
c.C1463G
p.P488R
p.P488R
12.11.0E-4D’Gama2015 T
ARID1B     SSC11660chr6:
157510805-157510805
AACexonicframeshift insertionNM_017519
NM_020732
c.3542dupC
c.3581dupC
p.T1181fs
p.T1194fs
--Antaki2022 GE
ARID1B     SP0113505chr6:
157505488-157505488
GAexonicDe novononsynonymous SNVNM_017519
NM_020732
c.G3430A
c.G3469A
p.E1144K
p.E1157K
22.9-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ARID1B     5-0110-003chr6:
157234912-157234914
TCCTintronicDe novo--Yuen2017 G
ARID1B     SP0020053chr6:
157522277-157522278
AGAexonicDe novoframeshift deletionNM_017519
NM_020732
c.4511delG
c.4550delG
p.S1504fs
p.S1517fs
--Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ARID1B     SP0080918chr6:
157510913-157510914
AGAexonicDe novoframeshift deletionNM_017519
NM_020732
c.3650delG
c.3689delG
p.R1217fs
p.R1230fs
--Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ARID1B     7-0461-003chr6:
157100116-157100119
AGGCAexonicDe novononframeshift deletionNM_017519
NM_020732
c.1054_1056del
c.1054_1056del
p.352_352del
p.352_352del
--Trost2022 G
ARID1B     1-0191-004chr6:
157700058-157700058
GAintergenicDe novo--Yuen2017 G
ARID1B     MSSNG00006-004chr6:
157213062-157213062
AGintronicDe novo--Trost2022 G
ARID1B     5-5202-003chr6:
157258169-157258169
GTintronicDe novo--Trost2022 G
ARID1B     13447.p1chr6:
157527664-157527668
CTGTTCexonicDe novoframeshift deletionNM_017519
NM_020732
c.5351_5354del
c.5390_5393del
p.L1784fs
p.L1797fs
--Dong2014 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lowther2023 G
O’Roak2012a T
O’Roak2012b E
Satterstrom2020 E
Trost2022 G
Wilfert2021 G
Willsey2013 E
Zhou2022 GE
ARID1B     MSSNG00255-004chr6:
157168038-157168038
CGintronicDe novo--Trost2022 G
ARID1B     3-0270-000chr6:
157197508-157197508
GAintronicDe novo--Trost2022 G
ARID1B     1-0239-003chr6:
157148256-157148256
CTintronicDe novo--Trost2022 G
ARID1B     AU4237304chr6:
157538185-157538185
CAintergenicDe novo--Yuen2017 G
ARID1B     1-1083-003chr6:
157160750-157160750
CTintronicDe novo--Trost2022 G
ARID1B     MSSNG00434-003chr6:
157124493-157124493
GTintronicDe novo--Trost2022 G
ARID1B     1-0844-003chr6:
157143044-157143044
CCTintronicDe novo--Trost2022 G
ARID1B     2-1186-003chr6:
157459100-157459100
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
ARID1B     7-0410-003chr6:
157397016-157397016
AGintronicDe novo--Trost2022 G
ARID1B     3-0703-000chr6:
157431386-157431386
CTintronicDe novo--Trost2022 G
ARID1B     3-0662-000chr6:
157352432-157352432
TCintronicDe novo--Trost2022 G
ARID1B     1-0548-003chr6:
157368636-157368636
CGintronicDe novo--Trost2022 G
ARID1B     2-1306-003chr6:
157311604-157311605
GTAGintronicDe novo--Trost2022 G
ARID1B     2-1694-003chr6:
157315731-157315731
TCintronicDe novo--Trost2022 G
ARID1B     2-1796-003chr6:
157267106-157267106
GAintronicDe novo--Trost2022 G
ARID1B     1-0700-003Achr6:
157309324-157309324
CAintronicDe novo--Trost2022 G
ARID1B     MSSNG00355-004chr6:
157453776-157453776
CTintronicDe novo--Trost2022 G
ARID1B     SP0236700chr6:
157505405-157505405
TCexonicnonsynonymous SNVNM_017519
NM_020732
c.T3347C
c.T3386C
p.L1116P
p.L1129P
17.8-Zhou2022 GE
ARID1B     2-1692-003chr6:
157458513-157458514
GTGintronicDe novo--Trost2022 G
ARID1B     1-1109-003chr6:
157444294-157444294
CTintronicDe novo--Trost2022 G
ARID1B     1-0980-003chr6:
157451049-157451049
TCintronicDe novo--Trost2022 G
ARID1B     3-0113-000chr6:
157436755-157436755
GAintronicDe novo--Trost2022 G
ARID1B     MSSNG00337-003chr6:
157437254-157437254
CTintronicDe novo--Trost2022 G
ARID1B     2-0214-003chr6:
157691414-157691414
TAintergenicDe novo--Yuen2017 G
ARID1B     SP0160988chr6:
157100436-157100455
CGGCGGCGGGGGCGGCGGCGCexonicframeshift deletionNM_017519
NM_020732
c.1374_1392del
c.1374_1392del
p.A458fs
p.A458fs
--Zhou2022 GE
ARID1B     MT_167.3chr6:
157435393-157435393
CTintronicDe novo--Trost2022 G
ARID1B     4-0102-003chr6:
157436617-157436617
GAintronicDe novo--Trost2022 G
ARID1B     MSSNG00111-004chr6:
157500492-157500492
CGintronicDe novo--Trost2022 G
ARID1B     SP0242032chr6:
157502298-157502298
GAexonicDe novononsynonymous SNVNM_017519
NM_020732
c.G3292A
c.G3331A
p.G1098R
p.G1111R
32.0-Trost2022 G
ARID1B     3-0371-000chr6:
157498194-157498194
CGintronicDe novo--Trost2022 G
ARID1B     3-0371-000chr6:
157498391-157498391
TCintronicDe novo--Trost2022 G
ARID1B     Ishay2021:5chr6:
157405978-157405980
TGGTexonicDe novoframeshift deletionNM_017519
NM_020732
c.2182_2183del
c.2221_2222del
p.G728fs
p.G741fs
--Ishay2021 E
ARID1B     iHART1912chr6:
157454160-157454160
ACsplicingPaternalsplicing21.0-Ruzzo2019 G
ARID1B     iHART1910chr6:
157454160-157454160
ACsplicingPaternalsplicing21.0-Ruzzo2019 G
ARID1B     AU0901302chr6:
157256598-157256598
AGsplicingDe novosplicing17.618.238E-6Stessman2017 T
ARID1B     Codina-Sola2015:ASD_33chr6:
157406015-157406015
CTexonicPaternalnonsynonymous SNVNM_017519
NM_020732
c.C2218T
c.C2257T
p.P740S
p.P753S
27.7-Codina-Sola2015 E
ARID1B     Wang2023:791chr6:
157527679-157527679
CTexonicDe novostopgainNM_017519
NM_020732
c.C5365T
c.C5404T
p.R1789X
p.R1802X
43.0-Wang2023 E
ARID1B     M30880chr6:
157502187-157502187
GAexonicMaternalnonsynonymous SNVNM_017519
NM_020732
c.G3181A
c.G3220A
p.D1061N
p.D1074N
36.08.249E-6Guo2018 T
ARID1B     GX0170.p1chr6:
157405814-157405814
GAexonicMaternalnonsynonymous SNVNM_017519
NM_020732
c.G2017A
c.G2056A
p.D673N
p.D686N
31.0-Guo2018 T
ARID1B     E5J5Mchr6:
157454333-157454333
GTexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.G2504T
c.G2543T
p.G835V
p.G848V
27.88.987E-6Stessman2017 T
ARID1B     G01-GEA-53-HIchr6:
157528630-157528630
GAexonicDe novononsynonymous SNVNM_017519
NM_020732
c.G6316A
c.G6355A
p.V2106I
p.V2119I
13.512.472E-5Fu2022 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ARID1B     1-0300-003chr6:
157691364-157691364
TAintergenicDe novo--Yuen2017 G
ARID1B     Q6R5Cchr6:
157510782-157510782
CTexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.C3518T
c.C3557T
p.S1173L
p.S1186L
22.7-Stessman2017 T
ARID1B     14393.p1 Complex Event; expand row to view variants  De novoframeshift insertionNM_017519
NM_020732
NM_017519
NM_020732
c.3542dupC
c.3581dupC
c.3543dupC
c.3582dupC
p.T1181fs
p.T1194fs
p.T1181fs
p.T1194fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lowther2023 G
O’Roak2012a T
Satterstrom2020 E
Trost2022 G
Wilfert2021 G
Zhou2022 GE
ARID1B     14406.p1chr6:
157525120-157525120
AGexonicDe novononsynonymous SNVNM_017519
NM_020732
c.A4976G
c.A5015G
p.N1659S
p.N1672S
11.767.0E-4Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Wilfert2021 G
ARID1B     Hu2022:70chr6:
157521844-157521844
CAexonicDe novostopgainNM_017519
NM_020732
c.C4077A
c.C4116A
p.Y1359X
p.Y1372X
42.0-Hu2022 T
ARID1B     160759chr6:
157527732-157527732
GAexonicDe novostopgainNM_017519
NM_020732
c.G5418A
c.G5457A
p.W1806X
p.W1819X
44.0-Fu2022 E
ARID1B     13447_p1chr6:
157527664-157527668
CTGTTCexonicDe novoframeshift deletionNM_017519
NM_020732
c.5351_5354del
c.5390_5393del
p.L1784fs
p.L1797fs
--Fu2022 E
ARID1B     Alvarez-Mora2016:ASD-2chr6:
157099799-157099799
GAexonicPaternalnonsynonymous SNVNM_017519
NM_020732
c.G736A
c.G736A
p.G246S
p.G246S
10.850.0042Alvarez-Mora2016 T
ARID1B     2-0503-004chr6:
157691382-157691382
CCCAAintergenicDe novo--Yuen2017 G
ARID1B     AU045512chr6:
157385531-157385531
AGintronicDe novo--Trost2022 G
Yuen2017 G
ARID1B     1-0436-003chr6:
157494804-157494804
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
ARID1B     2-1485-003chr6:
157700064-157700064
GAintergenicDe novo--Yuen2017 G
ARID1B     AU3903301chr6:
157405903-157405903
GAexonicDe novosynonymous SNVNM_017519
NM_020732
c.G2106A
c.G2145A
p.P702P
p.P715P
-5.766E-5Trost2022 G
Yuen2017 G
Zhou2022 GE
ARID1B     A140275chr6:
157100600-157100600
TCexonicDe novononsynonymous SNVNM_017519
NM_020732
c.T1537C
c.T1537C
p.S513P
p.S513P
14.12-Fu2022 E
ARID1B     150163chr6:
157502187-157502187
GAexonicDe novononsynonymous SNVNM_017519
NM_020732
c.G3181A
c.G3220A
p.D1061N
p.D1074N
36.08.249E-6Fu2022 E
ARID1B     DEASD_2151_001chr6:
157431700-157431700
GAintronicDe novo--Fu2022 E
ARID1B     Lo2022:6chr6:
157525120-157525120
AGexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.A4976G
c.A5015G
p.N1659S
p.N1672S
11.767.0E-4Lo2022 T
ARID1B     Alvarez-Mora2016:ASD-44chr6:
157099185-157099185
CTexonicPaternalnonsynonymous SNVNM_017519
NM_020732
c.C122T
c.C122T
p.S41F
p.S41F
9.383-Alvarez-Mora2016 T
ARID1B     Lo2022:5chr6:
157522274-157522274
GAexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.G4507A
c.G4546A
p.V1503I
p.V1516I
16.291.0E-4Lo2022 T
ARID1B     Lo2022:8chr6:
157528049-157528049
GAexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.G5735A
c.G5774A
p.S1912N
p.S1925N
20.2-Lo2022 T
ARID1B     Lo2022:7chr6:
157527680-157527680
GAexonicPaternalnonsynonymous SNVNM_017519
NM_020732
c.G5366A
c.G5405A
p.R1789Q
p.R1802Q
10.531.649E-5Lo2022 T
ARID1B     SP0022099chr6:
157528565-157528565
ACexonicDe novononsynonymous SNVNM_017519
NM_020732
c.A6251C
c.A6290C
p.D2084A
p.D2097A
13.45-Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
ARID1B     Lo2022:2chr6:
157502199-157502199
ATexonicPaternalnonsynonymous SNVNM_017519
NM_020732
c.A3193T
c.A3232T
p.T1065S
p.T1078S
11.552.473E-5Lo2022 T
ARID1B     Lo2022:1chr6:
157405967-157405967
CTexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.C2170T
c.C2209T
p.P724S
p.P737S
22.09.063E-5Lo2022 T
ARID1B     Lo2022:4chr6:
157522073-157522073
GAexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.G4306A
c.G4345A
p.G1436S
p.G1449S
14.739.185E-5Lo2022 T
ARID1B     2-1629-003chr6:
157437530-157437530
AGintronicDe novo--Trost2022 G
Yuen2017 G
ARID1B     Alvarez-Mora2016:ASD-35chr6:
157099799-157099799
GAexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.G736A
c.G736A
p.G246S
p.G246S
10.850.0042Alvarez-Mora2016 T
ARID1B     Lo2022:3chr6:
157517313-157517313
GAexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.G3838A
c.G3877A
p.E1280K
p.E1293K
22.58.239E-6Lo2022 T
ARID1B     Alvarez-Mora2016:ASD-57chr6:
157099799-157099799
GAexonicPaternalnonsynonymous SNVNM_017519
NM_020732
c.G736A
c.G736A
p.G246S
p.G246S
10.850.0042Alvarez-Mora2016 T
ARID1B     SP0073804chr6:
157502298-157502298
GAexonicDe novononsynonymous SNVNM_017519
NM_020732
c.G3292A
c.G3331A
p.G1098R
p.G1111R
32.0-Fu2022 E
Trost2022 G
Zhou2022 GE
ARID1B     SP0078568chr6:
157502260-157502260
TCexonicDe novononsynonymous SNVNM_017519
NM_020732
c.T3254C
c.T3293C
p.L1085P
p.L1098P
26.2-Fu2022 E
Trost2022 G
Zhou2022 GE
ARID1B     309833chr6:
157517313-157517313
GAexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.G3838A
c.G3877A
p.E1280K
p.E1293K
22.58.239E-6Stessman2017 T
ARID1B     SP0081207chr6:
157528343-157528343
AACACGTTGGTexonicDe novononframeshift insertionNM_017519
NM_020732
c.6029_6030insCACGTTGGT
c.6068_6069insCACGTTGGT
p.N2010delinsNTLV
p.N2023delinsNTLV
--Fu2022 E
Zhou2022 GE
ARID1B     SP0043398chr6:
157527417-157527417
CAexonicDe novononsynonymous SNVNM_017519
NM_020732
c.C5103A
c.C5142A
p.N1701K
p.N1714K
0.165-Fu2022 E
Trost2022 G
Zhou2022 GE
ARID1B     SP0010628chr6:
157528862-157528862
GAexonicDe novononsynonymous SNVNM_017519
NM_020732
c.G6548A
c.G6587A
p.C2183Y
p.C2196Y
14.51-Fu2022 E
Trost2022 G
Zhou2022 GE
ARID1B     330872chr6:
157502272-157502272
GAexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.G3266A
c.G3305A
p.R1089Q
p.R1102Q
35.01.65E-5Stessman2017 T
ARID1B     2-0090-003chr6:
157150547-157150547
CTexonicDe novostopgainNM_017519
NM_020732
c.C1729T
c.C1729T
p.Q577X
p.Q577X
41.0-Trost2022 G
Yuen2017 G
Zhou2022 GE
ARID1B     SP0050119chr6:
157100097-157100116
CGGCGGCGGCAGCAGCAGGACexonicframeshift deletionNM_017519
NM_020732
c.1035_1053del
c.1035_1053del
p.A345fs
p.A345fs
--Zhou2022 GE
ARID1B     SP0133348chr6:
157517257-157517257
CTintronicDe novo--Fu2022 E
ARID1B     SP0096154chr6:
157099402-157099408
CCAGCAGCexonicnonframeshift deletionNM_017519
NM_020732
c.340_345del
c.340_345del
p.114_115del
p.114_115del
--Zhou2022 GE
ARID1B     MT_188.3chr6:
157222616-157222616
AGexonicDe novononsynonymous SNVNM_017519
NM_020732
c.A1844G
c.A1883G
p.Q615R
p.Q628R
16.4-Trost2022 G
Zhou2022 GE
ARID1B     5-0103-003chr6:
157550661-157550661
CTintergenicDe novo--Yuen2017 G
ARID1B     14640.p1chr6:
157100518-157100518
TGexonicsynonymous SNVNM_017519
NM_020732
c.T1455G
c.T1455G
p.A485A
p.A485A
--Zhou2022 GE
ARID1B     Mahjani2021:128chr6:
157517445-157517445
CTexonicstopgainNM_017519
NM_020732
c.C3970T
c.C4009T
p.R1324X
p.R1337X
43.0-Mahjani2021 E
ARID1B     2-0289-003chr6:
157691358-157691358
AACCACCintergenicDe novo--Yuen2017 G
ARID1B     12630.p1chr6:
157437787-157437787
CGintronicDe novo--Wilfert2021 G
ARID1B     14633.p1chr6:
157296103-157296103
AGintronicDe novo--Wilfert2021 G
ARID1B     220-9856-201chr6:
157488271-157488271
CTexonicDe novostopgainNM_017519
NM_020732
c.C2938T
c.C2977T
p.Q980X
p.Q993X
38.0-Stessman2017 T
Stessman2017 T
ARID1B     1-0290-003chr6:
157691382-157691382
CCCAAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More