or
or
Exact

Results for "PHF20"

Variant Events: 10

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PHF20     2-1336-004chr20:
34493388-34493388
AGintronicDe novo--Yuen2017 G
PHF20     11089.p1chr20:
34520250-34520250
CGintronicDe novo--Turner2016 G
PHF20     1-0336-003chr20:
34396865-34396865
CAintronicDe novo--Yuen2017 G
PHF20     1-0338-003chr20:
34508050-34508050
GTintronicDe novo--Yuen2017 G
PHF20     2-1339-003chr20:
34534725-34534725
GAintronicDe novo--Yuen2017 G
PHF20     1-0142-005chr20:
34534725-34534725
GAintronicDe novo--Yuen2017 G
PHF20     20.s1chr20:
34451133-34451133
AGexonicDe novononsynonymous SNVNM_016436c.A619Gp.K207E23.4-An2014 E
PHF20     1-1004-003chr20:
34428573-34428596
CCAGCAGCAGCAGCAGCAGCAGCACCAGCAGCAGCAGCAGCAGCAintronicDe novo--Yuen2017 G
PHF20     7-0059-003chr20:
34469276-34469276
GAintronicDe novo--Yuen2017 G
PHF20     AU4239301chr20:
34453256-34453256
CGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More