or
or
Exact

Results for "GABRG2"

Variant Events: 81

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GABRG2     2-0295-003chr5:
161991287-161991299
TAAAATCCTCAACTintergenicDe novo--Yuen2017 G
GABRG2     AU3712302chr5:
162452457-162452457
AGintergenicDe novo--Yuen2017 G
GABRG2     AU3787302chr5:
162282528-162282528
CTintergenicDe novo--Yuen2017 G
GABRG2     1-0925-003chr5:
162303490-162303490
CTintergenicDe novo--Yuen2017 G
GABRG2     1-0906-003chr5:
162334461-162334461
GAintergenicDe novo--Yuen2017 G
GABRG2     AU3716301chr5:
162057981-162057981
GAintergenicDe novo--Yuen2017 G
GABRG2     2-0081-003chr5:
161497619-161497619
GTintronicDe novo--Yuen2017 G
GABRG2     AU043804chr5:
162503358-162503358
CTintergenicDe novo--Yuen2017 G
GABRG2     SF0081985.p1chr5:
161580345-161580345
GTexonicDe novononsynonymous SNVNM_000816
NM_198904
NM_198903
c.G1375T
c.G1399T
c.G1519T
p.V459F
p.V467F
p.V507F
19.02-Wang2020 T
GABRG2     1-0139-005chr5:
162423845-162423845
AGintergenicDe novo--Yuen2017 G
GABRG2     AU4013302chr5:
161900969-161900970
CACintergenicDe novo--Yuen2017 G
GABRG2     2-0223-004chr5:
162669963-162669963
GAintergenicDe novo--Yuen2017 G
GABRG2     SF0047137.p1chr5:
161580316-161580317
TCTexonicDe novoframeshift deletionNM_000816
NM_198904
NM_198903
c.1347delC
c.1371delC
c.1491delC
p.F449fs
p.F457fs
p.F497fs
--Wang2020 T
GABRG2     2-1297-003chr5:
161634538-161634538
TCintergenicDe novo--Yuen2017 G
GABRG2     AU3905302chr5:
161916419-161916419
AGintergenicDe novo--Yuen2017 G
GABRG2     2-0242-005chr5:
162417344-162417344
GTintergenicDe novo--Yuen2017 G
GABRG2     AU1955302chr5:
162036805-162036805
TGintergenicDe novo--Yuen2017 G
GABRG2     7-0254-004chr5:
161826924-161826924
GAintergenicDe novo--Yuen2017 G
GABRG2     2-1364-003chr5:
162398310-162398310
TCintergenicDe novo--Yuen2017 G
GABRG2     2-1364-003chr5:
161641804-161641804
TGintergenicDe novo--Yuen2017 G
GABRG2     AU3862305chr5:
161779996-161779996
CGintergenicDe novo--Yuen2017 G
GABRG2     7-0167-003chr5:
161802493-161802493
TCintergenicDe novo--Yuen2017 G
GABRG2     04C37156chr5:
161576165-161576165
CTexonicUnknownnonsynonymous SNVNM_000816
NM_198904
NM_198903
c.C974T
c.C974T
c.C1094T
p.S325L
p.S325L
p.S365L
36.0-Wang2020 T
Wang2020 T
GABRG2     1-0467-003chr5:
162566169-162566169
CTintergenicDe novo--Yuen2017 G
GABRG2     1-0481-003chr5:
161748177-161748177
CTintergenicDe novo--Yuen2017 G
GABRG2     M23668chr5:
161531032-161531032
GAexonicUnknownnonsynonymous SNVNM_000816
NM_198904
NM_198903
c.G769A
c.G769A
c.G889A
p.G257R
p.G257R
p.G297R
21.6-Wang2020 T
Wang2020 T
GABRG2     2-0198-005chr5:
162375894-162375894
AGintergenicDe novo--Yuen2017 G
GABRG2     P082chr5:
161576159-161576159
GAexonicDe novononsynonymous SNVNM_000816
NM_198904
NM_198903
c.G968A
c.G968A
c.G1088A
p.R323Q
p.R323Q
p.R363Q
36.0-Long2019 ET
GABRG2     2-1163-003chr5:
161597837-161597837
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
GABRG2     AU3782302chr5:
162201139-162201139
AGintergenicDe novo--Yuen2017 G
GABRG2     2-1502-003chr5:
162294393-162294393
AGintergenicDe novo--Yuen2017 G
GABRG2     AU2108302chr5:
162217362-162217362
CTintergenicDe novo--Yuen2017 G
GABRG2     AU201Achr5:
161576159-161576159
GAexonicDe novononsynonymous SNVNM_000816
NM_198904
NM_198903
c.G968A
c.G968A
c.G1088A
p.R323Q
p.R323Q
p.R363Q
36.0-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Wang2020 T
GABRG2     2-1288-003chr5:
161707039-161707039
CTintergenicDe novo--Yuen2017 G
GABRG2     AU0452303chr5:
161587007-161587007
GAintergenicDe novo--Yuen2017 G
GABRG2     AU3964302chr5:
161828954-161828960
ACAATCAACAintergenicDe novo--Yuen2017 G
GABRG2     2-1220-003chr5:
161861335-161861335
TCintergenicDe novo--Yuen2017 G
GABRG2     05C48125chr5:
161580117-161580117
CTexonicUnknownnonsynonymous SNVNM_000816
NM_198904
NM_198903
c.C1147T
c.C1171T
c.C1291T
p.R383C
p.R391C
p.R431C
16.68.243E-6Wang2020 T
Wang2020 T
GABRG2     AU2029303chr5:
161981023-161981023
ATintergenicDe novo--Yuen2017 G
GABRG2     AU3881302chr5:
161876187-161876187
TCintergenicDe novo--Yuen2017 G
GABRG2     AU002903chr5:
161809941-161809941
CTintergenicDe novo--Yuen2017 G
GABRG2     AU3811305chr5:
162745417-162745417
ATintergenicDe novo--Yuen2017 G
GABRG2     AU3801301chr5:
162571901-162571901
CTintergenicDe novo--Yuen2017 G
GABRG2     2-1475-003chr5:
161932983-161932983
CTintergenicDe novo--Yuen2017 G
GABRG2     AU038204chr5:
161938553-161938553
TCintergenicDe novo--Yuen2017 G
GABRG2     1-0455-004chr5:
162322855-162322855
GAintergenicDe novo--Yuen2017 G
GABRG2     1-0570-003chr5:
161596223-161596223
GTintergenicDe novo--Yuen2017 G
GABRG2     7-0247-003chr5:
162472177-162472177
TCintergenicDe novo--Yuen2017 G
GABRG2     AU3727303chr5:
162180953-162180953
GTintergenicDe novo--Yuen2017 G
GABRG2     2-0198-004chr5:
162375894-162375894
AGintergenicDe novo--Yuen2017 G
GABRG2     14637.p1chr5:
162776516-162776516
CAintergenicDe novo--Turner2016 G
GABRG2     1-0065-005chr5:
161693919-161693919
TCintergenicDe novo--Yuen2017 G
GABRG2     1-0534-004chr5:
161497035-161497035
AGintronicDe novo--Yuen2017 G
GABRG2     AU3911302chr5:
162123011-162123011
GAintergenicDe novo--Yuen2017 G
GABRG2     2-1383-003chr5:
162609740-162609740
TGintergenicDe novo--Yuen2017 G
GABRG2     AU079104chr5:
162265303-162265303
ACintergenicDe novo--Yuen2017 G
GABRG2     JASD_Fam0081chr5:
161522557-161522557
GAexonicDe novononsynonymous SNVNM_000816
NM_198903
NM_198904
c.G316A
c.G316A
c.G316A
p.A106T
p.A106T
p.A106T
14.03-Takata2018 E
GABRG2     392901chr5:
161495049-161495049
CAexonicUnknownstopgainNM_000816
NM_198903
NM_198904
c.C44A
c.C44A
c.C44A
p.S15X
p.S15X
p.S15X
39.0-Wang2020 T
Wang2020 T
Wang2020 T
GABRG2     1-0560-003chr5:
162556427-162556427
TCintergenicDe novo--Yuen2017 G
GABRG2     13143.p1chr5:
162089847-162089847
TCintergenicDe novo--Wilfert2021 G
GABRG2     AU3713301chr5:
161757237-161757237
TCintergenicDe novo--Yuen2017 G
GABRG2     392899chr5:
161495049-161495049
CAexonicUnknownstopgainNM_000816
NM_198903
NM_198904
c.C44A
c.C44A
c.C44A
p.S15X
p.S15X
p.S15X
39.0-Wang2020 T
Wang2020 T
GABRG2     1-0715-003chr5:
162140418-162140418
AGintergenicDe novo--Yuen2017 G
GABRG2     AU3057302chr5:
162594889-162594889
CTintergenicDe novo--Yuen2017 G
GABRG2     AU3716302chr5:
162057981-162057981
GAintergenicDe novo--Yuen2017 G
GABRG2     AU3716302chr5:
162360229-162360229
GTintergenicDe novo--Yuen2017 G
GABRG2     AU2029302chr5:
161981023-161981023
ATintergenicDe novo--Yuen2017 G
GABRG2     1-0534-003chr5:
162746593-162746593
CAintergenicDe novo--Yuen2017 G
GABRG2     2-1295-003chr5:
162302609-162302624
CAGAGAGAGAGAGAGACAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
GABRG2     1-0806-003chr5:
162217466-162217466
TCintergenicDe novo--Yuen2017 G
GABRG2     1-0120-003chr5:
161673478-161673478
ACintergenicDe novo--Yuen2017 G
GABRG2     7-0250-003chr5:
161996614-161996615
CTCintergenicDe novo--Yuen2017 G
GABRG2     5-0128-003chr5:
161531362-161531362
GAintronicDe novo--Yuen2017 G
GABRG2     13711.p1chr5:
161522685-161522685
GAintronicMosaic--Dou2017 E
GABRG2     1-0007-003chr5:
162770733-162770749
AAATAATAATAATAATAAAATAATAATAATAintergenicDe novo--Yuen2017 G
GABRG2     1-0522-003chr5:
162801309-162801309
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
GABRG2     2-1194-003chr5:
161497967-161497967
GCintronicDe novo--Yuen2017 G
GABRG2     2-0063-005chr5:
162367376-162367376
CTintergenicDe novo--Yuen2017 G
GABRG2     3-0661-000chr5:
162779927-162779927
ACintergenicDe novo--Yuen2017 G
GABRG2     AU3984301chr5:
162365070-162365070
ACintergenicDe novo--Yuen2017 G
GABRG2     AU031004chr5:
162222569-162222569
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More