or
or
Exact

Results for "PCDH15"

Variant Events: 228

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PCDH15     10.s1chr10:
55583161-55583161
TGintronicDe novo--An2014 E
PCDH15     1-0051-005chr10:
55723657-55723657
GAintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     A3chr10:
57278582-57278582
GAintergenicDe novo--Wu2018 G
PCDH15     2-1702-003chr10:
56896150-56896150
CTintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     AU1995302chr10:
56980411-56980411
GAintergenicDe novo--Yuen2017 G
PCDH15     7-0249-004 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
PCDH15     08C76931chr10:
55617018-55617018
GAexonicDe novosynonymous SNVNM_001142765
NM_001142767
NM_001142768
NM_001142773
NM_001142764
NM_001142766
NM_033056
NM_001142763
c.C3510T
c.C3612T
c.C3657T
c.C3657T
c.C3723T
c.C3723T
c.C3723T
c.C3738T
p.S1170S
p.S1204S
p.S1219S
p.S1219S
p.S1241S
p.S1241S
p.S1241S
p.S1246S
-8.285E-6Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
PCDH15     AU011903chr10:
55652697-55652697
TGintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     AU072004chr10:
57341173-57341173
CTintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     1-0484-003chr10:
55939613-55939613
CAintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     1-0296-003chr10:
56402665-56402665
CAintronicDe novo--Yuen2017 G
PCDH15     2-1185-003chr10:
56623189-56623189
CAintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     1-0261-004chr10:
56490938-56490938
AGintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     2-0116-004chr10:
55667127-55667127
TCintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     mAGRE5313chr10:
55582465-55582465
ATexonicPaternalstopgainNM_001142767
NM_001142765
NM_001142766
NM_001142773
NM_001142768
NM_033056
NM_001142764
NM_001142763
c.T4901A
c.T4814A
c.T5012A
c.T4952A
c.T4961A
c.T5021A
c.T5027A
c.T5042A
p.L1634X
p.L1605X
p.L1671X
p.L1651X
p.L1654X
p.L1674X
p.L1676X
p.L1681X
46.0-Cirnigliaro2023 G
PCDH15     1-0455-004chr10:
56824190-56824190
TCintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     2-0298-003chr10:
56270763-56270763
GAintronicDe novo--Yuen2017 G
PCDH15     1-0142-005chr10:
56972027-56972027
CTintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     2-0143-004chr10:
55987360-55987360
GAintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     mAGRE4346chr10:
56138646-56138646
TTGexonicMaternalframeshift insertionNM_001142768
NM_001142773
NM_001142764
NM_001142765
NM_001142766
NM_001142767
NM_033056
NM_001142763
c.147dupC
c.147dupC
c.213dupC
c.213dupC
c.213dupC
c.213dupC
c.213dupC
c.228dupC
p.T50fs
p.T50fs
p.T72fs
p.T72fs
p.T72fs
p.T72fs
p.T72fs
p.T77fs
--Cirnigliaro2023 G
PCDH15     2-1362-003chr10:
57051437-57051437
GGAAAAAGAACintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     mAGRE5936chr10:
56077189-56077204
TTTGGGCACGGTCCTGTexonicPaternalnonframeshift deletionNM_001142767
NM_001142768
NM_001142773
NM_001142764
NM_001142765
NM_001142766
NM_033056
NM_001142763
c.595_606del
c.640_651del
c.640_651del
c.706_717del
c.706_717del
c.706_717del
c.706_717del
c.721_732del
p.199_202del
p.214_217del
p.214_217del
p.236_239del
p.236_239del
p.236_239del
p.236_239del
p.241_244del
-1.648E-5Cirnigliaro2023 G
PCDH15     mAGRE5935chr10:
56077189-56077204
TTTGGGCACGGTCCTGTexonicPaternalnonframeshift deletionNM_001142767
NM_001142768
NM_001142773
NM_001142764
NM_001142765
NM_001142766
NM_033056
NM_001142763
c.595_606del
c.640_651del
c.640_651del
c.706_717del
c.706_717del
c.706_717del
c.706_717del
c.721_732del
p.199_202del
p.214_217del
p.214_217del
p.236_239del
p.236_239del
p.236_239del
p.236_239del
p.241_244del
-1.648E-5Cirnigliaro2023 G
PCDH15     AU3713301chr10:
56289048-56289048
CTintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     mAGRE5681chr10:
56077174-56077174
GAexonicPaternalstopgainNM_001142767
NM_001142768
NM_001142773
NM_001142764
NM_001142765
NM_001142766
NM_033056
NM_001142763
c.C622T
c.C667T
c.C667T
c.C733T
c.C733T
c.C733T
c.C733T
c.C748T
p.R208X
p.R223X
p.R223X
p.R245X
p.R245X
p.R245X
p.R245X
p.R250X
37.02.0E-4Cirnigliaro2023 G
PCDH15     AU4007302chr10:
55582801-55582801
GGACTTexonicPaternalstopgainNM_001142767
NM_001142765
NM_001142766
NM_001142773
NM_001142768
NM_033056
NM_001142764
NM_001142763
c.4564_4565insAAGT
c.4477_4478insAAGT
c.4675_4676insAAGT
c.4615_4616insAAGT
c.4624_4625insAAGT
c.4684_4685insAAGT
c.4690_4691insAAGT
c.4705_4706insAAGT
p.S1522_L1523delinsX
p.S1493_L1494delinsX
p.S1559_L1560delinsX
p.S1539_L1540delinsX
p.S1542_L1543delinsX
p.S1562_L1563delinsX
p.S1564_L1565delinsX
p.S1569_L1570delinsX
-7.451E-5Cirnigliaro2023 G
PCDH15     10-1019-003chr10:
55679524-55679524
TCintronicDe novo--Trost2022 G
PCDH15     MSSNG00356-003chr10:
55687684-55687684
GAintronicDe novo--Trost2022 G
PCDH15     7-0342-005chr10:
55638146-55638152
CTATATACintronicDe novo--Trost2022 G
PCDH15     2-1239-003chr10:
56394915-56394921
AGTCTCCAintronicDe novo--Yuen2016 G
PCDH15     AU023012chr10:
55647606-55647606
GAintronicDe novo--Trost2022 G
PCDH15     AU4149301chr10:
55591824-55591824
TGintronicDe novo--Trost2022 G
PCDH15     36177chr10:
55581663-55581663
GAexonicDe novosynonymous SNVNM_001142767
NM_001142765
NM_001142766
NM_001142773
NM_001142768
NM_033056
NM_001142764
NM_001142763
c.C5703T
c.C5616T
c.C5814T
c.C5754T
c.C5763T
c.C5823T
c.C5829T
c.C5844T
p.V1901V
p.V1872V
p.V1938V
p.V1918V
p.V1921V
p.V1941V
p.V1943V
p.V1948V
-8.244E-6Fu2022 E
Trost2022 G
PCDH15     4-0062-003chr10:
55629817-55629817
TCintronicDe novo--Trost2022 G
PCDH15     AU004403chr10:
55583841-55583841
ACintronicDe novo--Trost2022 G
PCDH15     AU055603chr10:
55766394-55766394
AGintronicDe novo--Trost2022 G
PCDH15     5-5130-003chr10:
55794079-55794079
AGintronicDe novo--Trost2022 G
PCDH15     2-0002-005chr10:
56024041-56024041
AGintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     2-1238-003chr10:
55752086-55752086
CAintronicDe novo--Trost2022 G
PCDH15     1-0262-003Achr10:
55764722-55764722
ACintronicDe novo--Trost2022 G
PCDH15     AU2310301chr10:
55706527-55706527
TAintronicDe novo--Trost2022 G
PCDH15     AU2029302chr10:
56598143-56598143
GAintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     AU2192301chr10:
55715159-55715159
TCintronicDe novo--Trost2022 G
PCDH15     MSSNG00362-003chr10:
55689257-55689257
AGintronicDe novo--Trost2022 G
PCDH15     5-0009-003chr10:
55705014-55705014
ACintronicDe novo--Trost2022 G
PCDH15     1-0291-003chr10:
55978739-55978739
CTintronicDe novo--Trost2022 G
PCDH15     AU2441301chr10:
55980478-55980478
CTintronicDe novo--Trost2022 G
PCDH15     REACH000631chr10:
55943438-55943438
CTintronicDe novo--Trost2022 G
PCDH15     2-1155-003chr10:
56976565-56976565
AGintergenicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PCDH15     7-0051-003chr10:
55973671-55973671
GAintronicDe novo--Trost2022 G
PCDH15     2-0242-003chr10:
55960271-55960271
GAintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     1-1010-003chr10:
55883147-55883147
AGintronicDe novo--Trost2022 G
PCDH15     1-1038-003chr10:
55909376-55909376
GAintronicDe novo--Trost2022 G
PCDH15     AU2729301chr10:
55845030-55845030
ACintronicDe novo--Trost2022 G
PCDH15     AU059003chr10:
55858978-55858978
ACintronicDe novo--Trost2022 G
PCDH15     MSSNG00346-004chr10:
56097023-56097023
TGintronicDe novo--Trost2022 G
PCDH15     SP0046164chr10:
56106115-56106115
ACintronicDe novo--Trost2022 G
PCDH15     1-1034-003chr10:
55566407-55566407
GCexonicunknown9.737-Zhou2022 GE
PCDH15     AU2320301chr10:
56081360-56081360
TGintronicDe novo--Trost2022 G
PCDH15     2-1811-004chr10:
56092085-56092085
CAintronicDe novo--Trost2022 G
PCDH15     11002.p1chr10:
56104524-56104524
TCintronicDe novo--Turner2016 G
PCDH15     1-0601-003chr10:
56000086-56000086
GAintronicDe novo--Trost2022 G
PCDH15     14153.p1chr10:
56436850-56436850
GAintronicDe novo--Turner2016 G
PCDH15     MSSNG00365-003chr10:
56003038-56003038
GAintronicDe novo--Trost2022 G
PCDH15     REACH000141chr10:
55983087-55983087
GAintronicDe novo--Trost2022 G
PCDH15     11194.p1chr10:
55891225-55891225
AGintronicDe novo--Turner2016 G
PCDH15     1-0604-003chr10:
56822539-56822539
CAintergenicDe novo--Yuen2017 G
PCDH15     4-0062-003chr10:
55989330-55989330
CTintronicDe novo--Trost2022 G
PCDH15     1-1071-003chr10:
56143109-56143109
CGintronicDe novo--Trost2022 G
PCDH15     REACH000517chr10:
56157942-56157943
ATAintronicDe novo--Trost2022 G
PCDH15     11002.p1chr10:
56501337-56501337
AGintronicDe novo--Turner2016 G
PCDH15     2-0103-003chr10:
56128783-56128783
CAintronicDe novo--Trost2022 G
PCDH15     AU2320301chr10:
56134559-56134559
CGintronicDe novo--Trost2022 G
PCDH15     1-0756-004chr10:
56109420-56109422
AAAGTAGTCintronicDe novo--Trost2022 G
PCDH15     4-0037-004chr10:
56118476-56118476
GTintronicDe novo--Trost2022 G
PCDH15     SP0046164chr10:
56106119-56106119
ACintronicDe novo--Trost2022 G
PCDH15     SP0046164chr10:
56106121-56106121
ACintronicDe novo--Trost2022 G
PCDH15     3-0454-000chr10:
56247184-56247184
ACintronicDe novo--Trost2022 G
PCDH15     AU2310301chr10:
56257412-56257412
GCintronicDe novo--Trost2022 G
PCDH15     MSSNG00421-007chr10:
56232308-56232308
TCintronicDe novo--Trost2022 G
PCDH15     5-0009-003chr10:
56239542-56239542
TGintronicDe novo--Trost2022 G
PCDH15     MSSNG00328-003chr10:
56203127-56203128
GTGintronicDe novo--Trost2022 G
PCDH15     7-0346-003chr10:
56210647-56210647
TGintronicDe novo--Trost2022 G
PCDH15     3-0294-000chr10:
56180211-56180211
ATintronicDe novo--Trost2022 G
PCDH15     MSSNG00362-004chr10:
56200849-56200849
GAintronicDe novo--Trost2022 G
PCDH15     3-0202-000chr10:
56388748-56388748
AGintronicDe novo--Trost2022 G
PCDH15     3-0602-000chr10:
56394149-56394150
TCTintronicDe novo--Trost2022 G
PCDH15     MSSNG00218-003chr10:
56369958-56369958
TCintronicDe novo--Trost2022 G
PCDH15     3-0640-000chr10:
56388241-56388241
ACintronicDe novo--Trost2022 G
PCDH15     2-1760-003chr10:
56330158-56330159
TCTintronicDe novo--Trost2022 G
PCDH15     MT_160.3chr10:
56333383-56333383
TCintronicDe novo--Trost2022 G
PCDH15     SJD_63.3chr10:
56272870-56272870
AGintronicDe novo--Trost2022 G
PCDH15     2-1180-003chr10:
57171906-57171906
CGintergenicDe novo--Yuen2016 G
PCDH15     1-0722-003chr10:
56295036-56295036
TCintronicDe novo--Trost2022 G
PCDH15     REACH000171chr10:
56480298-56480298
CAintronicDe novo--Trost2022 G
PCDH15     3-0461-000chr10:
56483527-56483527
ATintronicDe novo--Trost2022 G
PCDH15     1-0138-004chr10:
55819285-55819285
TCintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     2-1411-003chr10:
57220629-57220640
CTTGGAAATGGTCintergenicDe novo--Yuen2016 G
PCDH15     2-0198-004chr10:
56456817-56456821
ACATCTintronicDe novo--Trost2022 G
PCDH15     7-0402-003chr10:
56457614-56457614
CTintronicDe novo--Trost2022 G
PCDH15     MSSNG00437-004chr10:
56421217-56421217
CAintronicDe novo--Trost2022 G
PCDH15     AU3506302chr10:
56766434-56766434
CTintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     REACH000639chr10:
56446854-56446854
TCintronicDe novo--Trost2022 G
PCDH15     AU2697301chr10:
56396354-56396354
GAintronicDe novo--Trost2022 G
PCDH15     610chr10:
56403059-56403059
TCintronicDe novo--Trost2022 G
PCDH15     1-1134-004chr10:
56601088-56601088
AGintergenicDe novo--Trost2022 G
PCDH15     AU055603chr10:
56610024-56610024
TGintergenicDe novo--Trost2022 G
PCDH15     5-0100-003chr10:
56563838-56563838
CTintergenicDe novo--Trost2022 G
PCDH15     MSSNG00421-006chr10:
56586307-56586307
AGintergenicDe novo--Trost2022 G
PCDH15     AU2310301chr10:
56527523-56527523
AGintronicDe novo--Trost2022 G
PCDH15     3-0471-000chr10:
56558247-56558247
ATintronicDe novo--Trost2022 G
PCDH15     AU2310301chr10:
56498813-56498813
TCintronicDe novo--Trost2022 G
PCDH15     3-0543-000chr10:
56508399-56508399
CCTintronicDe novo--Trost2022 G
PCDH15     2-1254-003chr10:
55627824-55627824
GTintronicDe novo--Yuen2016 G
PCDH15     4-0098-003chr10:
56742023-56742023
TCintergenicDe novo--Trost2022 G
PCDH15     REACH000288chr10:
56748033-56748033
TCintergenicDe novo--Trost2022 G
PCDH15     3-0781-000chr10:
56716194-56716194
ACintergenicDe novo--Trost2022 G
PCDH15     7-0423-003chr10:
56717951-56717951
GAintergenicDe novo--Trost2022 G
PCDH15     1-0844-004chr10:
56672220-56672220
GAintergenicDe novo--Trost2022 G
PCDH15     3-0089-000chr10:
56677516-56677516
AGintergenicDe novo--Trost2022 G
PCDH15     2-1276-003chr10:
55745934-55745935
ACAintronicDe novo--Yuen2016 G
Yuen2017 G
PCDH15     REACH000446chr10:
56613696-56613696
TCintergenicDe novo--Trost2022 G
PCDH15     MSSNG00095-003chr10:
56662820-56662820
CAintergenicDe novo--Trost2022 G
PCDH15     5-0071-003chr10:
56773197-56773199
TCTGACintergenicDe novo--Trost2022 G
PCDH15     REACH000097chr10:
56792017-56792017
GAintergenicDe novo--Trost2022 G
PCDH15     5-0071-003chr10:
56773194-56773194
TTAGintergenicDe novo--Trost2022 G
PCDH15     AU4032307chr10:
55944366-55944366
TGintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     9-0011-003chr10:
56773194-56773194
TTAGintergenicDe novo--Trost2022 G
PCDH15     MT_74.3chr10:
56761589-56761589
AGintergenicDe novo--Trost2022 G
PCDH15     REACH000709chr10:
56771893-56771893
CAintergenicDe novo--Trost2022 G
PCDH15     AU2224301chr10:
56756623-56756623
CGintergenicDe novo--Trost2022 G
PCDH15     AU004403chr10:
56759480-56759480
GAintergenicDe novo--Trost2022 G
PCDH15     SJD_8.4chr10:
56938629-56938629
ACintergenicDe novo--Trost2022 G
PCDH15     1-0555-003chr10:
56942954-56942955
TCATintergenicDe novo--Trost2022 G
PCDH15     1-0842-003chr10:
56884276-56884276
ATintergenicDe novo--Trost2022 G
PCDH15     MSSNG00350-004chr10:
56899540-56899540
TCintergenicDe novo--Trost2022 G
PCDH15     2-1090-003chr10:
56851445-56851445
GAintergenicDe novo--Trost2022 G
PCDH15     MSSNG00369-004chr10:
56871642-56871642
CGintergenicDe novo--Trost2022 G
PCDH15     3-0471-000chr10:
56846499-56846499
ATintergenicDe novo--Trost2022 G
PCDH15     REACH000239chr10:
56847171-56847171
TCintergenicDe novo--Trost2022 G
PCDH15     AU2029303chr10:
56598143-56598143
GAintergenicDe novo--Yuen2017 G
PCDH15     2-1723-003chr10:
57076493-57076493
CTintergenicDe novo--Trost2022 G
PCDH15     MSSNG00416-003chr10:
57098380-57098380
TCintergenicDe novo--Trost2022 G
PCDH15     1-1026-003chr10:
57010309-57010309
TTCintergenicDe novo--Trost2022 G
PCDH15     3-0221-000chr10:
57022183-57022183
CCATAintergenicDe novo--Trost2022 G
PCDH15     1-0332-003chr10:
57096422-57096422
GAintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     AU3610302chr10:
55825257-55825257
AGintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     REACH000219chr10:
56967005-56967005
TGintergenicDe novo--Trost2022 G
PCDH15     AU3610302chr10:
55826315-55826315
CTintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     1-0640-003chr10:
56981775-56981775
CTintergenicDe novo--Trost2022 G
PCDH15     2-1750-003chr10:
56955530-56955530
AGintergenicDe novo--Trost2022 G
PCDH15     SJD_3.3chr10:
56959155-56959155
CAintergenicDe novo--Trost2022 G
PCDH15     1-0043-003chr10:
57166526-57166529
AATGAintergenicDe novo--Trost2022 G
PCDH15     1-0092-003chr10:
57166526-57166529
AATGAintergenicDe novo--Trost2022 G
PCDH15     1-0043-003chr10:
57166503-57166521
ATGAATGGTATTTAAAGCCAintergenicDe novo--Trost2022 G
PCDH15     1-0092-003chr10:
57166503-57166521
ATGAATGGTATTTAAAGCCAintergenicDe novo--Trost2022 G
PCDH15     MSSNG00395-003chr10:
57166500-57166500
CTintergenicDe novo--Trost2022 G
PCDH15     2-1279-003chr10:
56375286-56375286
AGintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     1-0043-003chr10:
57166500-57166500
CTintergenicDe novo--Trost2022 G
PCDH15     AU059003chr10:
57112995-57112995
AGintergenicDe novo--Trost2022 G
PCDH15     4-0062-003chr10:
57127583-57127584
TACTintergenicDe novo--Trost2022 G
PCDH15     4-0037-003chr10:
57182317-57182317
TCintergenicDe novo--Trost2022 G
PCDH15     7-0260-003chr10:
57199415-57199415
AGintergenicDe novo--Trost2022 G
PCDH15     1-0092-003chr10:
57166541-57166546
CAGGAGCintergenicDe novo--Trost2022 G
PCDH15     AU2310301chr10:
57180125-57180125
AGintergenicDe novo--Trost2022 G
PCDH15     1-0043-003chr10:
57166538-57166539
TGCTintergenicDe novo--Trost2022 G
PCDH15     1-0043-003chr10:
57166541-57166546
CAGGAGCintergenicDe novo--Trost2022 G
PCDH15     1-0043-003chr10:
57166532-57166535
TGAGCintergenicDe novo--Trost2022 G
PCDH15     1-0868-003chr10:
56490111-56490111
GAintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     1-0092-003chr10:
57166532-57166535
TGAGCintergenicDe novo--Trost2022 G
PCDH15     AU055603chr10:
57289659-57289659
CTintergenicDe novo--Trost2022 G
PCDH15     3-0396-000chr10:
57298745-57298745
TCintergenicDe novo--Trost2022 G
PCDH15     MSSNG00391-003chr10:
57268896-57268907
TCGAGGTATGCATintergenicDe novo--Trost2022 G
PCDH15     3-0070-000chr10:
57273176-57273176
AGintergenicDe novo--Trost2022 G
PCDH15     REACH000454chr10:
57234462-57234462
AGintergenicDe novo--Trost2022 G
PCDH15     AU055603chr10:
57243224-57243224
TGintergenicDe novo--Trost2022 G
PCDH15     5-0009-003chr10:
57206850-57206850
GTintergenicDe novo--Trost2022 G
PCDH15     REACH000751chr10:
57223858-57223858
TAintergenicDe novo--Trost2022 G
PCDH15     AU3371305chr10:
57034561-57034561
AGintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     1-0876-003Achr10:
57346144-57346144
TGintergenicDe novo--Trost2022 G
PCDH15     7-0374-003chr10:
57309205-57309205
TCintergenicDe novo--Trost2022 G
PCDH15     MSSNG00423-003chr10:
57315943-57315943
GAintergenicDe novo--Trost2022 G
PCDH15     Lim2017:36177chr10:
55581663-55581663
GAexonicDe novosynonymous SNVNM_001142767
NM_001142765
NM_001142766
NM_001142773
NM_001142768
NM_033056
NM_001142764
NM_001142763
c.C5703T
c.C5616T
c.C5814T
c.C5754T
c.C5763T
c.C5823T
c.C5829T
c.C5844T
p.V1901V
p.V1872V
p.V1938V
p.V1918V
p.V1921V
p.V1941V
p.V1943V
p.V1948V
-8.244E-6Lim2017 E
PCDH15     1-0290-003chr10:
56472646-56472646
AGintronicDe novo--Yuen2017 G
PCDH15     1-0377-003chr10:
55856382-55856382
GAintronicDe novo--Yuen2017 G
PCDH15     AU4336301chr10:
57196467-57196467
GAintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     1-0304-003chr10:
55874572-55874572
GAintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     2-0210-005chr10:
56305621-56305621
AAACTTintronicDe novo--Yuen2017 G
PCDH15     3-0436-000chr10:
57122623-57122623
CAintergenicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PCDH15     7-0167-003chr10:
55800336-55800336
GAintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     1-0304-003chr10:
55874582-55874582
GCintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     7-0248-003chr10:
56913815-56913815
GCintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     2-1333-003chr10:
56767259-56767259
CAintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     AU0540301chr10:
57107705-57107705
AGintergenicDe novo--Yuen2017 G
PCDH15     AU4410302chr10:
56979329-56979329
TCintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     14400_p1chr10:
55698706-55698706
CTexonicDe novononsynonymous SNVNM_001142765
NM_001142767
NM_001142768
NM_001142773
NM_001142764
NM_001142766
NM_033056
NM_001142763
c.G3029A
c.G3131A
c.G3176A
c.G3176A
c.G3242A
c.G3242A
c.G3242A
c.G3257A
p.G1010E
p.G1044E
p.G1059E
p.G1059E
p.G1081E
p.G1081E
p.G1081E
p.G1086E
6.738-Fu2022 E
PCDH15     1-0674-004chr10:
56110707-56110707
TCintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     AU4435301chr10:
56407158-56407158
GAintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     14423.p1chr10:
55581663-55581663
GAexonicDe novosynonymous SNVNM_001142767
NM_001142765
NM_001142766
NM_001142773
NM_001142768
NM_033056
NM_001142764
NM_001142763
c.C5703T
c.C5616T
c.C5814T
c.C5754T
c.C5763T
c.C5823T
c.C5829T
c.C5844T
p.V1901V
p.V1872V
p.V1938V
p.V1918V
p.V1921V
p.V1941V
p.V1943V
p.V1948V
-8.244E-6Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
Zhou2022 GE
PCDH15     14400.p1chr10:
55698706-55698706
CTexonicDe novononsynonymous SNVNM_001142765
NM_001142767
NM_001142768
NM_001142773
NM_001142764
NM_001142766
NM_033056
NM_001142763
c.G3029A
c.G3131A
c.G3176A
c.G3176A
c.G3242A
c.G3242A
c.G3242A
c.G3257A
p.G1010E
p.G1044E
p.G1059E
p.G1059E
p.G1081E
p.G1081E
p.G1081E
p.G1086E
6.738-Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
PCDH15     AU1860302chr10:
56292708-56292708
TCintronicDe novo--Yuen2017 G
PCDH15     SP0128256chr10:
55826599-55826599
TCexonicDe novononsynonymous SNVNM_001142765
NM_001142767
NM_001142768
NM_001142773
NM_001142764
NM_001142766
NM_033056
NM_001142763
c.A1925G
c.A2027G
c.A2072G
c.A2072G
c.A2138G
c.A2138G
c.A2138G
c.A2153G
p.N642S
p.N676S
p.N691S
p.N691S
p.N713S
p.N713S
p.N713S
p.N718S
24.0-Fu2022 E
Trost2022 G
Zhou2022 GE
PCDH15     5-0116-003chr10:
56569113-56569113
CTintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     AU2089302chr10:
57179585-57179585
CTintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     1-0305-004chr10:
56966776-56966776
TCintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     AU4235303chr10:
57153562-57153562
CGintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     1-0906-003chr10:
56398120-56398120
CAintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     AU3398301chr10:
55978157-55978157
CGintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     AU3725302chr10:
57059028-57059028
TCintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     AU4467302 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
PCDH15     1-0518-003chr10:
56194490-56194490
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PCDH15     1-0252-003chr10:
55769772-55769772
TCintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     2-1107-003chr10:
56974406-56974406
TAintergenicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PCDH15     AU4215302chr10:
55928753-55928755
CGTCintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     AU2950301chr10:
56590238-56590238
GAintergenicDe novo--Yuen2017 G
PCDH15     A20chr10:
57045790-57045790
GCintergenicDe novo--Wu2018 G
PCDH15     5-0050-003chr10:
56596789-56596789
AGintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     2-1366-003chr10:
56549144-56549146
CTACintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     AU2123302chr10:
56806276-56806276
AGintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     1-0595-005chr10:
56263688-56263688
CCATintronicDe novo--Yuen2017 G
PCDH15     08C73987chr10:
55583160-55583160
GCintronicDe novo--Satterstrom2020 E
Trost2022 G
PCDH15     2-1731-003chr10:
56190894-56190894
GTintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     AU1698301chr10:
55583734-55583734
TCintronicDe novo--Yuen2017 G
PCDH15     1-0213-004chr10:
55825061-55825061
TCintronicDe novo--Trost2022 G
Yuen2017 G
PCDH15     AU024004chr10:
57145895-57145895
AGintergenicDe novo--Yuen2017 G
PCDH15     AU4191302chr10:
56722193-56722193
GAintergenicDe novo--Trost2022 G
Yuen2017 G
PCDH15     2-1461-003chr10:
56133319-56133319
TCintronicDe novo--Yuen2016 G
PCDH15     1-0321-004chr10:
57248380-57248380
AATintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More