or
or
Exact

Results for "COL4A3"

Variant Events: 16

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
COL4A3     iHART1277chr2:
228113209-228113209
CCGexonicMaternalframeshift insertionNM_000091c.520dupGp.P173fs-8.323E-6Ruzzo2019 G
COL4A3     REACH000627chr2:
228082705-228082705
AGintronicDe novo--Trost2022 G
COL4A3     12249.p1chr2:
228120751-228120751
GAexonicMosaicnonsynonymous SNVNM_000091c.G898Ap.G300R16.412.491E-5Krupp2017 E
COL4A3     3-0191-000chr2:
228083884-228083884
AATintronicDe novo--Trost2022 G
COL4A3     1-0572-003chr2:
228067965-228067965
AGintronicDe novo--Yuen2017 G
COL4A3     10-0006-003chr2:
228073399-228073400
TCAAintronicDe novo--Trost2022 G
COL4A3     SJD_49.3chr2:
228080026-228080026
CTintronicDe novo--Trost2022 G
COL4A3     DEASD_1009_001chr2:
228137760-228137760
CTexonicDe novosynonymous SNVNM_000091c.C1854Tp.Y618Y-8.329E-6Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
COL4A3     SP0132213chr2:
228175629-228175629
CTexonicDe novosynonymous SNVNM_000091c.C4893Tp.F1631F-0.0036Trost2022 G
COL4A3     SP0051533chr2:
228128645-228128645
CAexonicDe novononsynonymous SNVNM_000091c.C1300Ap.P434T7.598-Fu2022 E
Trost2022 G
Zhou2022 GE
COL4A3     AU3808305chr2:
228145154-228145154
ACsplicingPaternalsplicing18.09-Cirnigliaro2023 G
COL4A3     AU3808304chr2:
228145154-228145154
ACsplicingPaternalsplicing18.09-Cirnigliaro2023 G
COL4A3     mAGRE1277chr2:
228113209-228113209
CCGexonicMaternalframeshift insertionNM_000091c.520dupGp.P173fs-8.323E-6Cirnigliaro2023 G
COL4A3     SP0056132chr2:
228029471-228029495
AGGTGCTCCTGCTGCCGCTCCTGCTAexonicDe novononframeshift deletionNM_000091c.30_53delp.10_18del-5.0E-4Fu2022 E
Zhou2022 GE
COL4A3     SP0077637chr2:
228029487-228029487
GTexonicDe novosynonymous SNVNM_000091c.G45Tp.P15P--Fu2022 E
Trost2022 G
Trost2022 G
Zhou2022 GE
COL4A3     5-0050-003chr2:
228043039-228043039
CTintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More