or
or
Exact

Results for "FOXP2"

Variant Events: 30

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FOXP2     AU4219302chr7:
114555725-114555725
TCintergenicDe novo--Yuen2017 G
FOXP2     AU1860301chr7:
114164940-114164940
ATintronicDe novo--Yuen2017 G
FOXP2     1-0564-003chr7:
114271579-114271605
CCAGCAGCAGCAGCAGCAGCAGCAGCACCAGCAGCAGCAGCAGCAGCAGCAexonicDe novononframeshift deletionNM_148899
NM_001172766
NM_001172767
NM_014491
NM_148898
NM_148900
c.618_620del
c.615_617del
c.693_695del
c.618_620del
c.693_695del
c.669_671del
p.206_207del
p.205_206del
p.231_232del
p.206_207del
p.231_232del
p.223_224del
--Yuen2017 G
FOXP2     Lim2017:11010chr7:
114298286-114298286
CTexonicDe novostopgainNM_001172766
NM_014491
NM_148898
NM_148900
c.C1429T
c.C1432T
c.C1507T
c.C1483T
p.R477X
p.R478X
p.R503X
p.R495X
38.0-Lim2017 E
FOXP2     A8chr7:
114261089-114261089
AGintronicDe novo--Wu2018 G
FOXP2     14595.p1chr7:
114269649-114269649
TTTexonicPaternalframeshift insertionNM_148900c.399dupTp.D133fs--O’Roak2012a T
FOXP2     SF0134162.p1chr7:
114299670-114299670
TCexonicDe novononsynonymous SNVNM_001172766
NM_014491
NM_148898
NM_148900
c.T1586C
c.T1589C
c.T1664C
c.T1640C
p.I529T
p.I530T
p.I555T
p.I547T
12.22-Wang2020 T
FOXP2     AU3849303chr7:
114196802-114196802
TCintronicDe novo--Yuen2017 G
FOXP2     AU3885304chr7:
114332543-114332543
GAUTR3De novo--Yuen2017 G
FOXP2     Schaaf2011:26chr7:
114304425-114304425
AGexonicUnknownnonsynonymous SNVNM_001172766
NM_014491
NM_148898
NM_148900
c.A1934G
c.A1937G
c.A2012G
c.A1988G
p.N645S
p.N646S
p.N671S
p.N663S
14.592.0E-4Schaaf2011 T
FOXP2     Schaaf2011:27chr7:
114329917-114329917
ACexonicDe novononsynonymous SNVNM_001172766
NM_014491
NM_148898
NM_148900
c.A2081C
c.A2084C
c.A2159C
c.A2135C
p.H694P
p.H695P
p.H720P
p.H712P
13.36-Schaaf2011 T
FOXP2     Schaaf2011:25chr7:
114294044-114294044
CAexonicUnknownnonsynonymous SNVNM_148899
NM_001172766
NM_001172767
NM_014491
NM_148898
NM_148900
c.C1246A
c.C1243A
c.C1321A
c.C1246A
c.C1321A
c.C1297A
p.P416T
p.P415T
p.P441T
p.P416T
p.P441T
p.P433T
17.18.242E-6Schaaf2011 T
FOXP2     Schaaf2011:28chr7:
114329933-114329933
ATexonicUnknownnonsynonymous SNVNM_001172766
NM_014491
NM_148898
NM_148900
c.A2097T
c.A2100T
c.A2175T
c.A2151T
p.E699D
p.E700D
p.E725D
p.E717D
2.8476.611E-5Schaaf2011 T
FOXP2     2-1406-003chr7:
114209276-114209276
ATintronicDe novo--Yuen2016 G
Yuen2017 G
FOXP2     Schaaf2011:103chr7:
114271605-114271605
AAAGCexonicDe novononframeshift insertionNM_148899
NM_001172766
NM_001172767
NM_014491
NM_148898
NM_148900
c.620_621insAGC
c.617_618insAGC
c.695_696insAGC
c.620_621insAGC
c.695_696insAGC
c.671_672insAGC
p.Q207delinsQA
p.Q206delinsQA
p.Q232delinsQA
p.Q207delinsQA
p.Q232delinsQA
p.Q224delinsQA
--Schaaf2011 T
FOXP2     1-0551-004chr7:
114533428-114533428
TTTGGintergenicDe novo--Yuen2017 G
FOXP2     AU4483301chr7:
114524465-114524465
CAintergenicDe novo--Yuen2017 G
FOXP2     AU4310301chr7:
114382371-114382371
TCintergenicDe novo--Yuen2017 G
FOXP2     AU4359301chr7:
114496796-114496796
GAintergenicDe novo--Yuen2017 G
FOXP2     AU076508chr7:
114232383-114232383
TGintronicDe novo--Yuen2017 G
FOXP2     11010chr7:
114298286-114298286
CTexonicDe novostopgainNM_001172766
NM_014491
NM_148898
NM_148900
c.C1429T
c.C1432T
c.C1507T
c.C1483T
p.R477X
p.R478X
p.R503X
p.R495X
38.0-Satterstrom2020 E
FOXP2     1-0446-003chr7:
114295837-114295837
GAintronicDe novo--Yuen2017 G
FOXP2     Mahjani2021:132chr7:
114292289-114292289
CTexonicstopgainNM_148899
NM_001172766
NM_001172767
NM_014491
NM_148898
NM_148900
c.C1126T
c.C1123T
c.C1201T
c.C1126T
c.C1201T
c.C1177T
p.R376X
p.R375X
p.R401X
p.R376X
p.R401X
p.R393X
28.6-Mahjani2021 E
FOXP2     AU2162302chr7:
114509761-114509761
CTintergenicDe novo--Yuen2017 G
FOXP2     11084.p1chr7:
114269955-114269955
GAexonicDe novosynonymous SNVNM_148899
NM_001172766
NM_001172767
NM_014491
NM_148898
NM_148900
c.G492A
c.G492A
c.G567A
c.G492A
c.G567A
c.G543A
p.Q164Q
p.Q164Q
p.Q189Q
p.Q164Q
p.Q189Q
p.Q181Q
--Krumm2015 E
FOXP2     11084.p1chr7:
114269976-114269976
AACAACAGexonicDe novononframeshift insertionNM_148899
NM_001172766
NM_001172767
NM_014491
NM_148898
NM_148900
c.513_514insCAACAG
c.513_514insCAACAG
c.588_589insCAACAG
c.513_514insCAACAG
c.588_589insCAACAG
c.564_565insCAACAG
p.Q171delinsQQQ
p.Q171delinsQQQ
p.Q196delinsQQQ
p.Q171delinsQQQ
p.Q196delinsQQQ
p.Q188delinsQQQ
--Krumm2015 E
FOXP2     11084.p1chr7:
114269967-114269967
GAexonicDe novosynonymous SNVNM_148899
NM_001172766
NM_001172767
NM_014491
NM_148898
NM_148900
c.G504A
c.G504A
c.G579A
c.G504A
c.G579A
c.G555A
p.Q168Q
p.Q168Q
p.Q193Q
p.Q168Q
p.Q193Q
p.Q185Q
--Krumm2015 E
FOXP2     1-0075-003chr7:
114176419-114176419
TCintronicDe novo--Yuen2017 G
FOXP2     11084.p1chr7:
114270006-114270006
GAexonicDe novosynonymous SNVNM_148899
NM_001172766
NM_001172767
NM_014491
NM_148898
NM_148900
c.G543A
c.G543A
c.G618A
c.G543A
c.G618A
c.G594A
p.Q181Q
p.Q181Q
p.Q206Q
p.Q181Q
p.Q206Q
p.Q198Q
--Krumm2015 E
FOXP2     1693001chr7:
114302129-114302129
CTexonicDe novononsynonymous SNVNM_001172766
NM_014491
NM_148898
NM_148900
c.C1654T
c.C1657T
c.C1732T
c.C1708T
p.R552C
p.R553C
p.R578C
p.R570C
18.048.298E-6Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More