or
or
Exact

Results for "TSC2"

Variant Events: 89

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TSC2     M23182chr16:
2129166-2129166
GAexonicMaternalnonsynonymous SNVNM_001077183
NM_000548
NM_001114382
c.G2968A
c.G3100A
c.G3100A
p.V990I
p.V1034I
p.V1034I
34.04.991E-5Guo2018 T
Wang2016 T
TSC2     M17674chr16:
2100431-2100431
CTexonicPaternal, Unknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.C169T
c.C169T
c.C169T
p.R57C
p.R57C
p.R57C
18.39-Guo2018 T
Stessman2017 T
Wang2016 T
TSC2     M17608chr16:
2138133-2138133
AGexonicUnknownnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.A4952G
c.A5084G
c.A5153G
p.H1651R
p.H1695R
p.H1718R
13.56-Wang2016 T
TSC2     13862.p1chr16:
2115563-2115563
GTexonicDe novononsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.G1643T
c.G1643T
c.G1643T
p.R548M
p.R548M
p.R548M
19.51-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
TSC2     12621.p1chr16:
2136269-2136269
CTexonicDe novononsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.C4537T
c.C4669T
c.C4738T
p.R1513W
p.R1557W
p.R1580W
15.981.672E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
O’Roak2012b E
Satterstrom2020 E
Wilfert2021 G
TSC2     M18377chr16:
2134428-2134428
GCexonicMaternalnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.G4004C
c.G4136C
c.G4205C
p.G1335A
p.G1379A
p.G1402A
9.075-Guo2018 T
Wang2016 T
TSC2     M8647chr16:
2124210-2124210
GAexonicUnknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.G2365A
c.G2365A
c.G2365A
p.V789I
p.V789I
p.V789I
17.594.188E-5Wang2016 T
TSC2     2-1738-003chr16:
2134693-2134693
GCexonicDe novononsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.G4269C
c.G4401C
c.G4470C
p.E1423D
p.E1467D
p.E1490D
17.8-Yuen2017 G
TSC2     AU4250301chr16:
2121882-2121882
GCexonicDe novononsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.G2044C
c.G2044C
c.G2044C
p.G682R
p.G682R
p.G682R
19.11-Yuen2017 G
TSC2     Husson2020:79chr16:
2129329-2129333
GTTGGGexonicframeshift deletionNM_001077183
NM_000548
NM_001114382
c.3053_3056del
c.3185_3188del
c.3185_3188del
p.V1018fs
p.V1062fs
p.V1062fs
--Husson2020 E
TSC2     M27891chr16:
2098606-2098606
CTUTR5Maternal2.572-Guo2018 T
Wang2016 T
TSC2     AU017403chr16:
2110776-2110776
CGexonicMaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.C1081G
c.C1081G
c.C1081G
p.L361V
p.L361V
p.L361V
16.97-Zhou2019 T
TSC2     Lim2017:6301chr16:
2136269-2136269
CTexonicDe novononsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.C4537T
c.C4669T
c.C4738T
p.R1513W
p.R1557W
p.R1580W
15.981.672E-5Lim2017 E
TSC2     SSC09669chr16:
2115563-2115563
GTexonicDe novononsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.G1643T
c.G1643T
c.G1643T
p.R548M
p.R548M
p.R548M
19.51-Lim2017 E
TSC2     M23096chr16:
2138324-2138324
CTexonicMaternalnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.C5056T
c.C5188T
c.C5257T
p.R1686W
p.R1730W
p.R1753W
16.032.509E-5Guo2018 T
Wang2016 T
TSC2     M19723chr16:
2106706-2106706
CTexonicMaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.C710T
c.C710T
c.C710T
p.P237L
p.P237L
p.P237L
22.83.299E-5Guo2018 T
Wang2016 T
TSC2     M15076chr16:
2107160-2107160
TCexonicMaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.T829C
c.T829C
c.T829C
p.C277R
p.C277R
p.C277R
14.32-Guo2018 T
Wang2016 T
TSC2     AU039303chr16:
2136283-2136295
GAAGGACTGCCAGGexonicDe novononframeshift deletionNM_001077183
NM_001114382
NM_000548
c.4552_4563del
c.4684_4695del
c.4753_4764del
p.1518_1521del
p.1562_1565del
p.1585_1588del
--Zhou2019 T
TSC2     iHART2635chr16:
2125890-2125890
CTexonicDe novononsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.C2636T
c.C2636T
c.C2636T
p.S879F
p.S879F
p.S879F
10.39-Ruzzo2019 G
TSC2     M18921chr16:
2138544-2138544
CGexonicPaternalnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.C5156G
c.C5288G
c.C5357G
p.P1719R
p.P1763R
p.P1786R
11.455.873E-5Guo2018 T
Wang2016 T
TSC2     M17590chr16:
2112989-2112989
GAexonicPaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.G1378A
c.G1378A
c.G1378A
p.A460T
p.A460T
p.A460T
15.920.0024Guo2018 T
Wang2016 T
TSC2     M13338chr16:
2115530-2115530
GAexonicPaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.G1610A
c.G1610A
c.G1610A
p.R537H
p.R537H
p.R537H
11.152.474E-5Guo2018 T
Wang2016 T
TSC2     EGAN00001101319chr16:
2138293-2138311
CCGGCTCCGCCACATCAAGCexonicDe novononframeshift deletionNM_001077183
NM_001114382
NM_000548
c.5026_5043del
c.5158_5175del
c.5227_5244del
p.1676_1681del
p.1720_1725del
p.1743_1748del
--Satterstrom2020 E
TSC2     M15096chr16:
2104360-2104360
GAexonicPaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.G400A
c.G400A
c.G400A
p.E134K
p.E134K
p.E134K
14.26-Guo2018 T
Wang2016 T
TSC2     M20655chr16:
2104384-2104384
GAexonicPaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.G424A
c.G424A
c.G424A
p.V142I
p.V142I
p.V142I
19.08-Guo2018 T
Wang2016 T
TSC2     M12504chr16:
2121610-2121610
GAexonicPaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.G1939A
c.G1939A
c.G1939A
p.D647N
p.D647N
p.D647N
34.04.0E-4Guo2018 T
Wang2016 T
TSC2     M16114chr16:
2135023-2135023
AGexonicPaternalnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.A4364G
c.A4496G
c.A4565G
p.N1455S
p.N1499S
p.N1522S
12.348.324E-5Guo2018 T
Wang2016 T
TSC2     M08840chr16:
2129284-2129284
GAexonicPaternalnonsynonymous SNVNM_001077183
NM_000548
NM_001114382
c.G3007A
c.G3139A
c.G3139A
p.V1003M
p.V1047M
p.V1047M
16.061.665E-5Guo2018 T
TSC2     M32044chr16:
2130243-2130243
CTexonicPaternalnonsynonymous SNVNM_001077183
NM_000548
NM_001114382
c.C3343T
c.C3475T
c.C3475T
p.R1115W
p.R1159W
p.R1159W
15.464.0E-4Guo2018 T
TSC2     HN0023.p1chr16:
2100429-2100429
AGexonicPaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.A167G
c.A167G
c.A167G
p.N56S
p.N56S
p.N56S
10.597.462E-5Guo2018 T
TSC2     M8840chr16:
2129284-2129284
GAexonicPaternalnonsynonymous SNVNM_001077183
NM_000548
NM_001114382
c.G3007A
c.G3139A
c.G3139A
p.V1003M
p.V1047M
p.V1047M
16.061.665E-5Wang2016 T
TSC2     M23280chr16:
2134692-2134692
AGexonicPaternalnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.A4268G
c.A4400G
c.A4469G
p.E1423G
p.E1467G
p.E1490G
19.032.0E-4Guo2018 T
Wang2016 T
TSC2     1-0673-003chr16:
2131391-2131391
CTintronicDe novo--Yuen2017 G
TSC2     M08458chr16:
2138229-2138229
TCexonicPaternalnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.T4961C
c.T5093C
c.T5162C
p.M1654T
p.M1698T
p.M1721T
15.66-Guo2018 T
TSC2     GX0086.p1chr16:
2134245-2134245
GAexonicPaternalnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.G3821A
c.G3953A
c.G4022A
p.S1274N
p.S1318N
p.S1341N
21.6-Guo2018 T
TSC2     03C16432chr16:
2107113-2107113
GAexonicUnknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.G782A
c.G782A
c.G782A
p.R261Q
p.R261Q
p.R261Q
33.0-Stessman2017 T
TSC2     Schaaf2011:71chr16:
2098633-2098633
GAexonicUnknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.G17A
c.G17A
c.G17A
p.S6N
p.S6N
p.S6N
21.33.319E-5Schaaf2011 T
TSC2     07C63795chr16:
2125890-2125890
CTexonicDe novononsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.C2636T
c.C2636T
c.C2636T
p.S879F
p.S879F
p.S879F
10.39-Satterstrom2020 E
TSC2     Schaaf2011:74chr16:
2103392-2103392
ATexonicUnknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.A275T
c.A275T
c.A275T
p.E92V
p.E92V
p.E92V
19.370.0019Schaaf2011 T
TSC2     Schaaf2011:75chr16:
2103406-2103406
GAexonicUnknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.G289A
c.G289A
c.G289A
p.A97T
p.A97T
p.A97T
28.7-Schaaf2011 T
TSC2     Schaaf2011:72chr16:
2100410-2100410
AGexonicUnknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.A148G
c.A148G
c.A148G
p.M50V
p.M50V
p.M50V
-4.979E-5Schaaf2011 T
TSC2     Schaaf2011:73chr16:
2100452-2100452
AGexonicUnknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.A190G
c.A190G
c.A190G
p.I64V
p.I64V
p.I64V
11.48-Schaaf2011 T
TSC2     Schaaf2011:78chr16:
2115529-2115529
CTexonicUnknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.C1609T
c.C1609T
c.C1609T
p.R537C
p.R537C
p.R537C
17.212.0E-4Schaaf2011 T
TSC2     Schaaf2011:79chr16:
2120556-2120556
AGexonicUnknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.A1816G
c.A1816G
c.A1816G
p.I606V
p.I606V
p.I606V
8.9523.336E-5Schaaf2011 T
TSC2     Schaaf2011:76chr16:
2112989-2112989
GAexonicUnknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.G1378A
c.G1378A
c.G1378A
p.A460T
p.A460T
p.A460T
15.920.0024Schaaf2011 T
TSC2     Schaaf2011:77chr16:
2114426-2114426
ACexonicUnknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.A1597C
c.A1597C
c.A1597C
p.K533Q
p.K533Q
p.K533Q
20.2-Schaaf2011 T
TSC2     Schaaf2011:82chr16:
2126141-2126141
CGexonicUnknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.C2712G
c.C2712G
c.C2712G
p.F904L
p.F904L
p.F904L
15.146.65E-5Schaaf2011 T
TSC2     M17425chr16:
2120496-2120496
GAexonicMaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.G1756A
c.G1756A
c.G1756A
p.V586M
p.V586M
p.V586M
17.482.493E-5Guo2018 T
Wang2016 T
TSC2     Schaaf2011:83chr16:
2127711-2127711
GCexonicUnknownnonsynonymous SNVNM_000548
NM_001114382
c.G2950C
c.G2950C
p.E984Q
p.E984Q
26.4-Schaaf2011 T
TSC2     M08470chr16:
2124222-2124222
GAexonicDe novononsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.G2377A
c.G2377A
c.G2377A
p.E793K
p.E793K
p.E793K
32.0-Guo2018 T
Stessman2017 T
Wang2016 T
TSC2     M8608chr16:
2138123-2138123
AGexonicMaternalnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.A4942G
c.A5074G
c.A5143G
p.M1648V
p.M1692V
p.M1715V
11.6-Wang2016 T
TSC2     Schaaf2011:80chr16:
2121576-2121576
TGexonicUnknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.T1905G
c.T1905G
c.T1905G
p.D635E
p.D635E
p.D635E
23.3-Schaaf2011 T
TSC2     Schaaf2011:81chr16:
2121870-2121870
GAexonicUnknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.G2032A
c.G2032A
c.G2032A
p.A678T
p.A678T
p.A678T
1.5260.0019Schaaf2011 T
TSC2     M20769chr16:
2100429-2100429
AGexonicMaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.A167G
c.A167G
c.A167G
p.N56S
p.N56S
p.N56S
10.597.462E-5Guo2018 T
Wang2016 T
TSC2     Schaaf2011:86chr16:
2134317-2134317
CTexonicUnknownnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.C3893T
c.C4025T
c.C4094T
p.S1298L
p.S1342L
p.S1365L
12.41.0E-4Schaaf2011 T
TSC2     Schaaf2011:87chr16:
2134329-2134329
GAexonicUnknownnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.G3905A
c.G4037A
c.G4106A
p.R1302Q
p.R1346Q
p.R1369Q
10.438.635E-6Schaaf2011 T
TSC2     Schaaf2011:84chr16:
2129566-2129566
CTexonicUnknownnonsynonymous SNVNM_001077183
NM_000548
NM_001114382
c.C3161T
c.C3293T
c.C3293T
p.P1054L
p.P1098L
p.P1098L
11.41.067E-5Schaaf2011 T
TSC2     Schaaf2011:85chr16:
2130190-2130190
CTexonicUnknownnonsynonymous SNVNM_001077183
NM_000548
NM_001114382
c.C3290T
c.C3422T
c.C3422T
p.A1097V
p.A1141V
p.A1141V
11.410.0018Schaaf2011 T
TSC2     1-0923-003chr16:
2118998-2118998
GCintronicDe novo--Yuen2017 G
TSC2     Schaaf2011:88chr16:
2134496-2134496
GAexonicUnknownnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.G4072A
c.G4204A
c.G4273A
p.G1358R
p.G1402R
p.G1425R
12.972.014E-5Schaaf2011 T
TSC2     PN400514chr16:
2135250-2135250
CTexonicUnknownnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.C4388T
c.C4520T
c.C4589T
p.S1463L
p.S1507L
p.S1530L
34.0-Leblond2019 E
TSC2     Schaaf2011:89chr16:
2138074-2138074
CAexonicUnknownnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.C4893A
c.C5025A
c.C5094A
p.S1631R
p.S1675R
p.S1698R
9.4494.0E-4Schaaf2011 T
TSC2     M20409chr16:
2131656-2131656
ATexonicMaternalnonsynonymous SNVNM_001077183
NM_000548
NM_001114382
c.A3539T
c.A3671T
c.A3671T
p.N1180I
p.N1224I
p.N1224I
21.5-Guo2018 T
Wang2016 T
TSC2     M8082chr16:
2138574-2138574
TCexonicUnknownnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.T5186C
c.T5318C
c.T5387C
p.L1729P
p.L1773P
p.L1796P
17.24-Wang2016 T
TSC2     05C46540chr16:
2125875-2125875
CTexonicUnknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.C2621T
c.C2621T
c.C2621T
p.P874L
p.P874L
p.P874L
31.0-Stessman2017 T
TSC2     M21572chr16:
2106226-2106226
CTexonicPaternal, Unknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.C629T
c.C629T
c.C629T
p.A210V
p.A210V
p.A210V
2.1378.294E-6Guo2018 T
Wang2016 T
TSC2     D’Gama2015:4231chr16:
2138267-2138267
GAexonicUnknownnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.G4999A
c.G5131A
c.G5200A
p.D1667N
p.D1711N
p.D1734N
25.08.307E-6D’Gama2015 T
TSC2     PN400111chr16:
2135250-2135250
CTexonicUnknownnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.C4388T
c.C4520T
c.C4589T
p.S1463L
p.S1507L
p.S1530L
34.0-Leblond2019 E
TSC2     05C48455chr16:
2138510-2138510
ATexonicDe novostopgainNM_001077183
NM_001114382
NM_000548
c.A5122T
c.A5254T
c.A5323T
p.K1708X
p.K1752X
p.K1775X
42.0-Stessman2017 T
Stessman2017 T
TSC2     M10087chr16:
2131656-2131656
ATexonicUnknownnonsynonymous SNVNM_001077183
NM_000548
NM_001114382
c.A3539T
c.A3671T
c.A3671T
p.N1180I
p.N1224I
p.N1224I
21.5-Wang2016 T
TSC2     Schaaf2011:101chr16:
2132466-2132475
AGCTGCCAAGAexonicDe novononframeshift deletionNM_000548c.3845_3853delp.1282_1285del--Schaaf2011 T
TSC2     359557chr16:
2124201-2124201
CAexonicUnknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.C2356A
c.C2356A
c.C2356A
p.R786S
p.R786S
p.R786S
18.22-Stessman2017 T
TSC2     211-5443-5chr16:
2134574-2134574
CTexonicUnknownnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.C4150T
c.C4282T
c.C4351T
p.R1384C
p.R1428C
p.R1451C
18.879.209E-6Stessman2017 T
TSC2     Lee2020:94chr16:
2136274-2136277
CATCCexonicnonframeshift deletionNM_001077183
NM_001114382
NM_000548
c.4543_4545del
c.4675_4677del
c.4744_4746del
p.1515_1515del
p.1559_1559del
p.1582_1582del
--Lee2020 T
TSC2     HN0092.p1chr16:
2115529-2115529
CTexonicMaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.C1609T
c.C1609T
c.C1609T
p.R537C
p.R537C
p.R537C
17.212.0E-4Guo2018 T
TSC2     GX0310.p1chr16:
2106732-2106732
AGexonicMaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.A736G
c.A736G
c.A736G
p.T246A
p.T246A
p.T246A
19.88.25E-6Guo2018 T
TSC2     HN0047.p1chr16:
2131656-2131656
ATexonicMaternalnonsynonymous SNVNM_001077183
NM_000548
NM_001114382
c.A3539T
c.A3671T
c.A3671T
p.N1180I
p.N1224I
p.N1224I
21.5-Guo2018 T
TSC2     GX0013.p1chr16:
2129068-2129068
GAexonicMaternalnonsynonymous SNVNM_001077183
NM_000548
NM_001114382
c.G2870A
c.G3002A
c.G3002A
p.G957E
p.G1001E
p.G1001E
29.61.665E-5Guo2018 T
TSC2     M23246chr16:
2106226-2106226
CTexonicPaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.C629T
c.C629T
c.C629T
p.A210V
p.A210V
p.A210V
2.1378.294E-6Guo2018 T
Wang2016 T
TSC2     M12507chr16:
2110684-2110684
CTexonicMaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.C989T
c.C989T
c.C989T
p.P330L
p.P330L
p.P330L
13.684.955E-5Guo2018 T
TSC2     M18393chr16:
2110765-2110765
CTexonicPaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.C1070T
c.C1070T
c.C1070T
p.A357V
p.A357V
p.A357V
14.215.0E-4Guo2018 T
Wang2016 T
TSC2     M04353chr16:
2106226-2106226
CC/TexonicMaternal--Guo2018 T
TSC2     M10105chr16:
2138319-2138319
GAexonicMaternalnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.G5051A
c.G5183A
c.G5252A
p.R1684H
p.R1728H
p.R1751H
23.21.674E-5Guo2018 T
TSC2     M08608chr16:
2138123-2138123
AGexonicMaternalnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.A4942G
c.A5074G
c.A5143G
p.M1648V
p.M1692V
p.M1715V
11.6-Guo2018 T
TSC2     M26886chr16:
2103365-2103365
AGexonicPaternal, Unknownnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.A248G
c.A248G
c.A248G
p.K83R
p.K83R
p.K83R
11.77-Guo2018 T
Wang2016 T
TSC2     GX0255.p1chr16:
2136789-2136789
GAexonicMaternalnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.G4705A
c.G4837A
c.G4906A
p.D1569N
p.D1613N
p.D1636N
14.442.741E-5Guo2018 T
TSC2     M20553chr16:
2134269-2134269
CTexonicPaternalnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.C3845T
c.C3977T
c.C4046T
p.A1282V
p.A1326V
p.A1349V
2.4234.041E-5Guo2018 T
Wang2016 T
TSC2     M13398chr16:
2103392-2103392
ATexonicMaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.A275T
c.A275T
c.A275T
p.E92V
p.E92V
p.E92V
19.370.0019Guo2018 T
TSC2     M8458chr16:
2138229-2138229
TCexonicPaternalnonsynonymous SNVNM_001077183
NM_001114382
NM_000548
c.T4961C
c.T5093C
c.T5162C
p.M1654T
p.M1698T
p.M1721T
15.66-Wang2016 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More