
Results for "Feliciano2019"

Variant Events: 717

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
ANK2     SP0020903chr4:
CTexonicDe novosynonymous SNVNM_001148
0.0180.0014Feliciano2019 E
GPX6     SP0000605chr6:
GAexonicDe novounknown18.18-Feliciano2019 E
SLC28A3     SP0041645chr9:
CTexonicDe novosynonymous SNVNM_001199633
-0.0036Feliciano2019 E
GNE     SP0019306chr9:
CTexonicDe novosynonymous SNVNM_001190384
-0.0015Feliciano2019 E
REC8     SP0024054chr14:
CTexonicDe novosynonymous SNVNM_001048205
-0.1107Feliciano2019 E
DEPDC5     SP0030187chr22:
GAintronicDe novo-0.0994Feliciano2019 E
TRIM36     SP0041539chr5:
CTexonicDe novosynonymous SNVNM_001300752
-0.1953Feliciano2019 E
PSAPL1     SP0048034chr4:
GAexonicDe novosynonymous SNVNM_001085382c.C1164Tp.D388D-0.1304Feliciano2019 E
NUMBL     SP0026711chr19:
GAexonicDe novosynonymous SNVNM_001289979
-0.0069Feliciano2019 E
THOP1     SP0010081chr19:
CTexonicDe novosynonymous SNVNM_003249c.C1719Tp.A573A-0.0059Feliciano2019 E
B4GALT2     SP0001571chr1:
CTexonicDe novosynonymous SNVNM_001005417
-0.0935Feliciano2019 E
SLC5A1     SP0038120chr22:
CTexonicDe novosynonymous SNVNM_001256314
-0.0502Feliciano2019 E
CR1     SP0029048chr1:
TCexonicDe novosynonymous SNVNM_000573
0.0318.291E-6Feliciano2019 E
EML3     SP0043178chr11:
CTexonicDe novosynonymous SNVNM_001300793
12.418.264E-6Feliciano2019 E
XPC     SP0006477chr3:
CTexonicDe novosynonymous SNVNM_004628c.G519Ap.A173A-9.07E-6Feliciano2019 E
CACNA1H     SP0004175chr16:
GAsplicingDe novosplicing9.4098.984E-6Feliciano2019 E
RNF25     SP0027065chr2:
TTCexonicDe novoframeshift insertionNM_022453c.749dupGp.G250fs-8.239E-6Feliciano2019 E
TMPRSS5     SP0018069chr11:
CCGexonicDe novoframeshift insertionNM_001288749
--Feliciano2019 E
ZNF454     SP0043178chr5:
CTexonicDe novostopgainNM_001178089
34.08.262E-6Feliciano2019 E
PTPN18     SP0028464chr2:
CTexonicDe novosynonymous SNVNM_014369c.C282Tp.G94G-8.242E-6Feliciano2019 E
TSPAN4     SP0020473chr11:
CTexonicDe novononsynonymous SNVNM_001025238
12.533.539E-5Feliciano2019 E
G3BP1     SP0042629chr5:
CTexonicDe novononsynonymous SNVNM_005754
16.442.474E-5Feliciano2019 E
ARHGAP10     SP0001890chr4:
AGexonicDe novononsynonymous SNVNM_024605c.A2026Gp.I676V0.0496.0E-4Feliciano2019 E
COL21A1     SP0018075chr6:
CCTCexonicDe novoframeshift deletionNM_030820c.2153_2154delp.Q718fs-4.0E-4Feliciano2019 E
DUS1L     SP0009232chr17:
CTexonicDe novosynonymous SNVNM_022156c.G1020Ap.P340P-9.405E-6Feliciano2019 E
ADAMTS15     SP0000753chr11:
AGsplicingDe novosplicing16.489.121E-6Feliciano2019 E
UNKL     SP0018301chr16:
TTCCCCACAGexonicDe novoframeshift insertionNM_001276414c.457_458insCTGTGGGGp.D153fs-1.451E-5Feliciano2019 E
NOC4L     SP0008074chr12:
CTexonicDe novononsynonymous SNVNM_024078c.C701Tp.A234V11.561.018E-5Feliciano2019 E
CHD8     SP0000759chr14:
AATexonicDe novoframeshift insertionNM_001170629
--Feliciano2019 E
ZNF548     SP0000117chr19:
AATTexonicDe novoframeshift insertionNM_152909
--Feliciano2019 E
TTC12     SP0000978chr11:
AGAexonicDe novoframeshift deletionNM_017868c.687delGp.K229fs--Feliciano2019 E
ABCF3     SP0000855chr3:
GAexonicDe novostopgainNM_018358c.G1095Ap.W365X35.0-Feliciano2019 E
SHANK3     SP0001367chr22:
GTsplicingDe novosplicing20.9-Feliciano2019 E
SHANK3     SP0051409chr22:
TTGexonicDe novoframeshift insertionNM_033517c.3630dupGp.L1210fs-6.0E-4Feliciano2019 E
CHCHD4     SP0047177chr3:
CAsplicingDe novosplicing2.642-Feliciano2019 E
PDE4DIP     SP0036741chr1:
CTsplicingMosaic, De novosplicing11.09-Feliciano2019 E
Feliciano2019 E
TRPM8     SP0001931chr2:
TGexonicDe novononsynonymous SNVNM_024080c.T2450Gp.L817R14.78-Feliciano2019 E
THBS1     SP0001817chr15:
CTexonicDe novostopgainNM_003246c.C2875Tp.R959X42.0-Feliciano2019 E
NBAS     SP0002235chr2:
TAsplicingDe novosplicing24.4-Feliciano2019 E
ATP6V0D2     SP0002090chr8:
GAexonicDe novononsynonymous SNVNM_152565c.G817Ap.V273I13.81-Feliciano2019 E
AKAP10     SP0001272chr17:
CTsplicingDe novosplicing15.07-Feliciano2019 E
KDM5B     SP0001272chr1:
CCAexonicDe novostopgainNM_006618
--Feliciano2019 E
ADNP     SP0001740chr20:
GACCCTTGGGGTCTAAAGCTAAAACAGexonicDe novoframeshift deletionNM_001282532
--Feliciano2019 E
PREX1     SP0001571chr20:
CGexonicDe novononsynonymous SNVNM_020820c.G1036Cp.A346P33.0-Feliciano2019 E
TRERF1     SP0003070chr6:
GAexonicDe novostopgainNM_001297573
46.0-Feliciano2019 E
TXK     SP0002657chr4:
AGexonicDe novosynonymous SNVNM_003328c.T18Cp.Y6Y--Feliciano2019 E
NBEA     SP0003496chr13:
CTexonicDe novostopgainNM_015678c.C433Tp.R145X43.0-Feliciano2019 E
CHD8     SP0003489chr14:
GAexonicDe novostopgainNM_001170629c.C706Tp.Q236X37.0-Feliciano2019 E
MAP3K15     SP0002235chrX:
TAsplicingDe novosplicing12.21-Feliciano2019 E
FBN2     SP0002235chr5:
TCTexonicDe novoframeshift deletionNM_001999c.1783delGp.D595fs--Feliciano2019 E
LYST     SP0002657chr1:
CTexonicDe novostopgainNM_000081
40.0-Feliciano2019 E
ALDH6A1     SP0002305chr14:
GCexonicDe novononsynonymous SNVNM_001278593
34.0-Feliciano2019 E
SRRM2     SP0008634chr16:
CTexonicDe novostopgainNM_016333c.C6178Tp.R2060X48.0-Feliciano2019 E
RALGAPB     SP0008074chr20:
AATexonicDe novoframeshift insertionNM_001282917
--Feliciano2019 E
SLC15A1     SP0009287chr13:
TCexonicDe novononsynonymous SNVNM_005073c.A1465Gp.R489G11.71-Feliciano2019 E
DUOX2     SP0009120chr15:
TTAGexonicDe novoframeshift insertionNM_014080c.3769_3770insCTp.Y1257fs--Feliciano2019 E
SYNGAP1     SP0006454chr6:
TCsplicingDe novosplicing18.83-Feliciano2019 E
FAT1     SP0006235chr4:
CTsplicingDe novosplicing16.95-Feliciano2019 E
ITGA4     SP0007370chr2:
CAGCexonicDe novoframeshift deletionNM_000885c.2287_2288delp.R763fs--Feliciano2019 E
ASXL3     SP0007002chr18:
TTATCCexonicDe novoframeshift insertionNM_030632c.5969_5970insATCCp.L1990fs--Feliciano2019 E
HNMT     SP0012364chr2:
ACexonicDe novosynonymous SNVNM_001024075
--Feliciano2019 E
CHD8     SP0011046chr14:
GCexonicDe novosynonymous SNVNM_001170629
--Feliciano2019 E
AFF3     SP0015356chr2:
CGCexonicDe novoframeshift deletionNM_001025108
--Feliciano2019 E
WDR20     SP0013376chr14:
ATAexonicDe novoframeshift deletionNM_001242416
--Feliciano2019 E
ARHGAP45     SP0009922chr19:
GTexonicDe novostopgainNM_001282334
39.0-Feliciano2019 E
C6orf106     SP0009874chr6:
TGTexonicDe novostopgainNM_022758
--Feliciano2019 E
FOXP1     SP0010429chr3:
GTGexonicDe novoframeshift deletionNM_001244813
--Feliciano2019 E
MYO9A     SP0010081chr15:
CTGCexonicDe novoframeshift deletionNM_006901c.4439_4440delp.T1480fs--Feliciano2019 E
ING2     SP0018345chr4:
AACAexonicDe novoframeshift deletionNM_001291959
--Feliciano2019 E
LZTR1     SP0018301chr22:
GTexonicDe novostopgainNM_006767c.G1549Tp.E517X43.0-Feliciano2019 E
AGPS     SP0018758chr2:
CTexonicDe novostopgainNM_003659c.C1543Tp.R515X38.0-Feliciano2019 E
DOCK8     SP0018345chr9:
GCsplicingDe novosplicing26.1-Feliciano2019 E
MISP     SP0016887chr19:
AGexonicDe novononsynonymous SNVNM_173481c.A1949Gp.E650G8.597-Feliciano2019 E
CHTF18     SP0016671chr16:
ATsplicingDe novosplicing12.61-Feliciano2019 E
GIGYF1     SP0017274chr7:
GAexonicDe novostopgainNM_022574c.C661Tp.R221X47.0-Feliciano2019 E
RCOR3     SP0017252chr1:
GAexonicDe novostopgainNM_018254
36.0-Feliciano2019 E
CBX1     SP0022360chr17:
GCGexonicDe novoframeshift deletionNM_001127228
--Feliciano2019 E
SLC24A1     SP0022360chr15:
TGAAGATexonicDe novoframeshift deletionNM_001254740
--Feliciano2019 E
CUBN     SP0022582chr10:
CTexonicDe novostopgainNM_001081c.G9924Ap.W3308X50.0-Feliciano2019 E
MRPL14     SP0022437chr6:
CCAexonicDe novoframeshift insertionNM_032111c.86dupTp.L29fs--Feliciano2019 E
FAM135A     SP0019186chr6:
CAexonicDe novostopgainNM_001162529
39.0-Feliciano2019 E
QRICH1     SP0018758chr3:
GAexonicDe novostopgainNM_198880
42.0-Feliciano2019 E
DMWD     SP0021004chr19:
GCGexonicDe novoframeshift deletionNM_004943c.983delGp.G328fs--Feliciano2019 E
SH3RF3     SP0020685chr2:
TCTexonicDe novoframeshift deletionNM_001099289c.1545delCp.F515fs--Feliciano2019 E
PLXNA2     SP0027605chr1:
CAsplicingDe novosplicing23.0-Feliciano2019 E
CHD3     SP0027448chr17:
TTAAGTexonicDe novononframeshift deletionNM_001005271
--Feliciano2019 E
IRF2BPL     SP0028603chr14:
CGCexonicDe novoframeshift deletionNM_024496c.1793delCp.P598fs--Feliciano2019 E
CNTNAP2     SP0028519chr7:
CTexonicDe novostopgainNM_014141c.C3058Tp.Q1020X39.0-Feliciano2019 E
FOXP1     SP0026093chr3:
CCCTGTAAAGCTGCAsplicingDe novosplicing--Feliciano2019 E
HNRNPU     SP0023172chr1:
GAexonicDe novostopgainNM_004501
37.0-Feliciano2019 E
PPCS     SP0027448chr1:
GCGexonicDe novoframeshift deletionNM_001287511
--Feliciano2019 E
MEIS2     SP0026296chr15:
GAexonicDe novostopgainNM_172315
40.0-Feliciano2019 E
YBX1     SP0033400chr1:
CCTexonicDe novoframeshift insertionNM_004559c.384dupTp.P128fs--Feliciano2019 E
CERS1     SP0032837chr19:
CTsplicingDe novosplicing19.47-Feliciano2019 E
SPRY1     SP0034714chr4:
CCAexonicDe novoframeshift insertionNM_001258039
--Feliciano2019 E
HRAS     SP0033959chr11:
CCGTTTexonicDe novoframeshift insertionNM_001130442
--Feliciano2019 E
AGRN     SP0030765chr1:
GAsplicingDe novosplicing8.842-Feliciano2019 E
PCDHGA12     SP0029029chr5:
GGAexonicDe novoframeshift insertionNM_003735
--Feliciano2019 E
CELF6       SP0032712chr15:
AGsplicingDe novosplicing21.3-Feliciano2019 E
SETD1A     SP0031524chr16:
TTCexonicDe novoframeshift insertionNM_014712c.1376dupCp.S459fs--Feliciano2019 E
CLASP2     SP0039371chr3:
TCexonicDe novononsynonymous SNVNM_001207044
14.53-Feliciano2019 E
SCN2A     SP0037822chr2:
ATexonicDe novostopgainNM_001040143
40.0-Feliciano2019 E
MRPS28     SP0040236chr8:
CGCexonicDe novoframeshift deletionNM_014018c.449delCp.T150fs--Feliciano2019 E
MBD5     SP0039864chr2:
TCAGATexonicDe novoframeshift deletionNM_018328c.2010_2013delp.L670fs--Feliciano2019 E
TTN     SP0037023chr2:
GAexonicDe novostopgainNM_003319
60.0-Feliciano2019 E
RERE     SP0034975chr1:
GAexonicDe novostopgainNM_001042681
41.0-Feliciano2019 E
BRSK2     SP0037695chr11:
ACAexonicDe novoframeshift deletionNM_001256627
--Feliciano2019 E
FEZF2     SP0037344chr3:
AGAexonicDe novoframeshift deletionNM_018008c.1191delCp.A397fs--Feliciano2019 E
DPP6     SP0043850chr7:
CTexonicDe novostopgainNM_001290252
39.0-Feliciano2019 E
CDHR2     SP0043623chr5:
GAexonicDe novosynonymous SNVNM_001171976
--Feliciano2019 E
LIG3     SP0045640chr17:
ACexonicDe novosynonymous SNVNM_002311
--Feliciano2019 E
CHD2     SP0045640chr15:
GAexonicDe novostopgainNM_001271c.G3782Ap.W1261X49.0-Feliciano2019 E
MOCS3     SP0041946chr20:
TGTexonicDe novoframeshift deletionNM_014484c.72delGp.L24fs--Feliciano2019 E
NR4A2     SP0041645chr2:
GCGexonicDe novoframeshift deletionNM_006186c.692delGp.G231fs--Feliciano2019 E
POGZ     SP0042394chr1:
CCTCexonicDe novoframeshift deletionNM_145796
--Feliciano2019 E
BRSK2     SP0042217chr11:
GAsplicingDe novosplicing12.1-Feliciano2019 E
CREBBP     SP0020403chr16:
GAexonicDe novononsynonymous SNVNM_001079846
21.18.24E-6Feliciano2019 E
RNF220     SP0026093chr1:
GAexonicDe novononsynonymous SNVNM_018150c.G1001Ap.G334D20.78.239E-6Feliciano2019 E
ADAMTS19     SP0024711chr5:
TCexonicDe novononsynonymous SNVNM_133638c.T2534Cp.I845T20.48.245E-6Feliciano2019 E
ITSN1     SP0007556chr21:
CTexonicDe novononsynonymous SNVNM_003024c.C4856Tp.P1619L27.98.243E-6Feliciano2019 E
TNFRSF8     SP0028519chr1:
CTexonicDe novononsynonymous SNVNM_001281430
14.54-Feliciano2019 E
CNDP1     SP0045640chr18:
ACsplicingDe novosplicing9.49-Feliciano2019 E
SRGAP3     SP0001367chr3:
AGexonicDe novononsynonymous SNVNM_001033117
17.128.237E-6Feliciano2019 E
SPTBN4     SP0003228chr19:
GAexonicDe novononsynonymous SNVNM_025213
11.71-Feliciano2019 E
STK10     SP0015507chr5:
CTexonicDe novononsynonymous SNVNM_005990c.G1232Ap.R411Q11.968.267E-6Feliciano2019 E
HSF2BP     SP0006651chr21:
TCexonicDe novononsynonymous SNVNM_007031c.A481Gp.M161V13.498.266E-6Feliciano2019 E
EHBP1     SP0001272chr2:
GAexonicDe novononsynonymous SNVNM_001142614
1.1728.287E-6Feliciano2019 E
LAMA3     SP0004280chr18:
AGexonicDe novononsynonymous SNVNM_001127717
24.48.281E-6Feliciano2019 E
ZSCAN32     SP0021852chr16:
GTexonicDe novononsynonymous SNVNM_001284529
0.5888.249E-6Feliciano2019 E
SLC26A5     SP0017106chr7:
GAexonicDe novononsynonymous SNVNM_001167962
12.298.247E-6Feliciano2019 E
TMEM175     SP0022437chr4:
GTexonicDe novononsynonymous SNVNM_001297424
15.798.256E-6Feliciano2019 E
DOCK8     SP0018345chr9:
CGintronicDe novo9.9068.256E-6Feliciano2019 E
ATP8B3     SP0014959chr19:
CTexonicDe novononsynonymous SNVNM_001178002
17.668.358E-6Feliciano2019 E
STXBP2     SP0034444chr19:
GAexonicDe novononsynonymous SNVNM_001127396
4.8578.358E-6Feliciano2019 E
CDH24     SP0001494chr14:
GAexonicDe novononsynonymous SNVNM_022478
7.1488.566E-6Feliciano2019 E
CORO2B     SP0028603chr15:
GAexonicDe novononsynonymous SNVNM_001190456
25.28.437E-6Feliciano2019 E
PGLYRP2     SP0026334chr19:
GAexonicDe novononsynonymous SNVNM_052890c.C943Tp.R315C16.48.298E-6Feliciano2019 E
TCHH     SP0000607chr1:
CTexonicDe novononsynonymous SNVNM_007113c.G1402Ap.E468K5.5398.288E-6Feliciano2019 E
FLII     SP0026711chr17:
CTexonicDe novononsynonymous SNVNM_001256265
6.0828.331E-6Feliciano2019 E
HIST1H4H     SP0028464chr6:
CGexonicDe novononsynonymous SNVNM_003543c.G41Cp.G14A17.878.314E-6Feliciano2019 E
PPP2R5C     SP0001272chr14:
GAexonicDe novononsynonymous SNVNM_002719
26.21.647E-5Feliciano2019 E
VEGFB     SP0017274chr11:
CTexonicDe novononsynonymous SNVNM_001243733
18.669.626E-6Feliciano2019 E
NALCN     SP0011385chr13:
CTexonicDe novononsynonymous SNVNM_052867c.G2282Ap.R761H29.21.649E-5Feliciano2019 E
NEK10     SP0009898chr3:
TCexonicDe novononsynonymous SNVNM_001031741
2.9351.649E-5Feliciano2019 E
UBAP2     SP0007188chr9:
GAexonicDe novononsynonymous SNVNM_001282530
17.729.058E-6Feliciano2019 E
CLIP2     SP0007102chr7:
CTexonicDe novononsynonymous SNVNM_003388
19.578.999E-6Feliciano2019 E
MEPCE     SP0033661chr7:
AGexonicDe novononsynonymous SNVNM_019606c.A503Gp.K168R21.79.39E-6Feliciano2019 E
KCNG3     SP0023136chr2:
CTexonicDe novononsynonymous SNVNM_133329
22.49.091E-6Feliciano2019 E
KDM2B     SP0029586chr12:
CTexonicDe novononsynonymous SNVNM_001005366
0.1141.658E-5Feliciano2019 E
KIF21B     SP0006651chr1:
GAexonicDe novononsynonymous SNVNM_001252100
23.21.657E-5Feliciano2019 E
TCHH     SP0011734chr1:
GTexonicDe novononsynonymous SNVNM_007113c.C3473Ap.P1158Q2.0751.661E-5Feliciano2019 E
NUPL2     SP0001571chr7:
CTexonicDe novononsynonymous SNVNM_007342c.C31Tp.R11W17.751.659E-5Feliciano2019 E
ITSN1     SP0005166chr21:
GAexonicDe novononsynonymous SNVNM_001001132
28.21.655E-5Feliciano2019 E
DAZAP1     SP0007121chr19:
CTexonicDe novononsynonymous SNVNM_018959
20.31.653E-5Feliciano2019 E
TTN     SP0020624chr2:
TGexonicDe novononsynonymous SNVNM_003319
13.371.657E-5Feliciano2019 E
SH3PXD2B     SP0001207chr5:
GAexonicDe novononsynonymous SNVNM_001017995c.C2138Tp.T713M1.9331.656E-5Feliciano2019 E
CBFA2T3     SP0003327chr16:
CTexonicDe novononsynonymous SNVNM_175931
23.01.744E-5Feliciano2019 E
TRMT61A     SP0031073chr14:
GAexonicDe novononsynonymous SNVNM_152307c.G368Ap.R123H28.31.677E-5Feliciano2019 E
FLG     SP0033959chr1:
GAexonicDe novononsynonymous SNVNM_002016c.C5540Tp.T1847M5.8772.471E-5Feliciano2019 E
BTAF1     SP0032561chr10:
AGexonicDe novononsynonymous SNVNM_003972c.A2396Gp.N799S0.1761.913E-5Feliciano2019 E
PNMT     SP0020347chr17:
CTexonicDe novononsynonymous SNVNM_002686c.C109Tp.R37C26.41.663E-5Feliciano2019 E
FUT6     SP0023136chr19:
GAexonicDe novononsynonymous SNVNM_001040701
9.5061.661E-5Feliciano2019 E
SPEG     SP0040398chr2:
CTexonicDe novononsynonymous SNVNM_005876c.C8492Tp.A2831V7.1191.677E-5Feliciano2019 E
IGDCC4     SP0031728chr15:
GAexonicDe novononsynonymous SNVNM_020962c.C2669Tp.T890M18.071.669E-5Feliciano2019 E
ATP11A     SP0000406chr13:
CTexonicDe novononsynonymous SNVNM_015205
30.02.495E-5Feliciano2019 E
GALNT4     SP0031996chr12:
CTexonicDe novononsynonymous SNVNM_003774
22.12.487E-5Feliciano2019 E
WFDC3     SP0010944chr20:
CTexonicDe novononsynonymous SNVNM_080614c.G197Ap.R66Q6.2722.502E-5Feliciano2019 E
ITGB6     SP0000087chr2:
CTexonicDe novononsynonymous SNVNM_001282354
14.272.5E-5Feliciano2019 E
KLF5     SP0022669chr13:
GAexonicDe novononsynonymous SNVNM_001286818
24.62.48E-5Feliciano2019 E
LAMA4     SP0043581chr6:
GAexonicDe novononsynonymous SNVNM_001105206
25.62.474E-5Feliciano2019 E
GLYCTK     SP0004721chr3:
GAexonicDe novononsynonymous SNVNM_001144951
9.5822.485E-5Feliciano2019 E
ZFYVE28     SP0014748chr4:
CTexonicDe novononsynonymous SNVNM_001172656
26.92.481E-5Feliciano2019 E
ARHGAP22     SP0006823chr10:
GAexonicDe novononsynonymous SNVNM_001256026
14.83.175E-5Feliciano2019 E
ASB12     SP0037814chrX:
GAexonicDe novononsynonymous SNVNM_130388c.C232Tp.R78C20.12.861E-5Feliciano2019 E
ATN1     SP0012230chr12:
GAexonicDe novononsynonymous SNVNM_001007026
14.233.296E-5Feliciano2019 E
CHD3     SP0000124chr17:
GAexonicDe novononsynonymous SNVNM_001005271
14.23.295E-5Feliciano2019 E
CBFA2T3     SP0001491chr16:
GAexonicDe novononsynonymous SNVNM_175931
17.562.537E-5Feliciano2019 E
CELSR3     SP0004355chr3:
CTexonicDe novononsynonymous SNVNM_001407c.G8513Ap.R2838Q23.72.513E-5Feliciano2019 E
HUWE1     SP0034740chrX:
TCexonicDe novononsynonymous SNVNM_031407c.A10384Gp.I3462V13.782.612E-5Feliciano2019 E
AMPD2     SP0042217chr1:
CTexonicMosaic, De novononsynonymous SNVNM_004037
21.32.538E-5Feliciano2019 E
Feliciano2019 E
WRN     SP0036741chr8:
CTexonicDe novononsynonymous SNVNM_000553c.C4274Tp.T1425M9.3823.333E-5Feliciano2019 E
MYO15A     SP0019630chr17:
GAexonicDe novononsynonymous SNVNM_016239c.G4666Ap.A1556T28.33.322E-5Feliciano2019 E
CERS4     SP0029048chr19:
GAexonicDe novononsynonymous SNVNM_024552c.G608Ap.R203H29.33.346E-5Feliciano2019 E
POLH     SP0018718chr6:
GAexonicDe novononsynonymous SNVNM_001291969
36.03.336E-5Feliciano2019 E
CELSR2     SP0041645chr1:
GAexonicDe novononsynonymous SNVNM_001408c.G7429Ap.G2477S22.63.302E-5Feliciano2019 E
CYP17A1     SP0042217chr10:
GAexonicDe novononsynonymous SNVNM_000102c.C286Tp.R96W15.923.297E-5Feliciano2019 E
DTD1     SP0003070chr20:
GAexonicDe novononsynonymous SNVNM_080820c.G341Ap.R114H24.93.318E-5Feliciano2019 E
LHX4     SP0010732chr1:
GAexonicDe novononsynonymous SNVNM_033343c.G410Ap.R137Q17.693.316E-5Feliciano2019 E
KDM1B     SP0001207chr6:
GAexonicDe novononsynonymous SNVNM_153042c.G1681Ap.A561T23.14.122E-5Feliciano2019 E
TXN2     SP0037695chr22:
CTexonicDe novononsynonymous SNVNM_012473c.G149Ap.R50Q16.644.118E-5Feliciano2019 E
NADSYN1     SP0036859chr11:
CTexonicDe novononsynonymous SNVNM_018161c.C1174Tp.R392C18.34.138E-5Feliciano2019 E
CALD1     SP0022099chr7:
GAexonicDe novononsynonymous SNVNM_033140
30.04.122E-5Feliciano2019 E
PABPN1L     SP0023723chr16:
GAexonicDe novononsynonymous SNVNM_001080487c.C637Tp.R213W12.923.432E-5Feliciano2019 E
RNH1     SP0000626chr11:
CTexonicDe novononsynonymous SNVNM_203384
6.3983.361E-5Feliciano2019 E
PRLH     SP0004355chr2:
GAexonicDe novononsynonymous SNVNM_015893c.G71Ap.R24H4.5883.61E-5Feliciano2019 E
APC2     SP0019700chr19:
CTexonicMosaic, De novononsynonymous SNVNM_005883c.C1462Tp.R488C17.823.44E-5Feliciano2019 E
Feliciano2019 E
PRAM1     SP0011385chr19:
GAexonicDe novononsynonymous SNVNM_032152c.C1451Tp.S484L16.184.904E-5Feliciano2019 E
HSPBP1     SP0035025chr19:
GAexonicDe novononsynonymous SNVNM_001297600
19.284.889E-5Feliciano2019 E
PRG4     SP0006667chr1:
GAexonicDe novononsynonymous SNVNM_001127710
19.894.946E-5Feliciano2019 E
FER1L6     SP0001491chr8:
GAexonicDe novononsynonymous SNVNM_001039112c.G4327Ap.D1443N35.04.944E-5Feliciano2019 E
SERPINB7     SP0001995chr18:
GAexonicDe novononsynonymous SNVNM_001261831
14.64.143E-5Feliciano2019 E
SLC26A4     SP0000972chr7:
AGexonicDe novononsynonymous SNVNM_000441c.A803Gp.N268S23.84.139E-5Feliciano2019 E
HS6ST1     SP0002974chr2:
GAexonicDe novononsynonymous SNVNM_004807c.C1189Tp.R397C15.744.633E-5Feliciano2019 E
PTPRU     SP0036288chr1:
CTexonicDe novononsynonymous SNVNM_001195001
19.64.272E-5Feliciano2019 E
MOB3B     SP0037814chr9:
CTexonicDe novononsynonymous SNVNM_024761c.G98Ap.R33Q14.296.59E-5Feliciano2019 E
ZP3     SP0003489chr7:
GAexonicDe novononsynonymous SNVNM_001110354c.G115Ap.V39I8.1296.351E-5Feliciano2019 E
PAMR1     SP0015379chr11:
CTexonicDe novononsynonymous SNVNM_001001991
19.776.591E-5Feliciano2019 E
HSD17B2     SP0038333chr16:
CTexonicDe novononsynonymous SNVNM_002153c.C323Tp.T108M11.376.59E-5Feliciano2019 E
PLEKHM1     SP0010944chr17:
CTexonicDe novononsynonymous SNVNM_014798c.G1862Ap.R621Q10.835.041E-5Feliciano2019 E
NAGLU     SP0018069chr17:
AGexonicDe novononsynonymous SNVNM_000263c.A419Gp.Y140C25.44.947E-5Feliciano2019 E
CUL7     SP0046673chr6:
CTexonicDe novononsynonymous SNVNM_001168370
20.45.814E-5Feliciano2019 E
TBC1D10B     SP0023444chr16:
GAexonicDe novononsynonymous SNVNM_015527c.C1681Tp.R561C17.055.637E-5Feliciano2019 E
POTEC     SP0042592chr18:
CTexonicDe novononsynonymous SNVNM_001137671c.G1309Ap.A437T5.1551.0E-4Feliciano2019 E
HAUS6     SP0024794chr9:
GAexonicDe novononsynonymous SNVNM_001270890
17.771.0E-4Feliciano2019 E
CNTRL     SP0031728chr9:
GAexonicDe novononsynonymous SNVNM_007018c.G6698Ap.R2233H15.831.0E-4Feliciano2019 E
TIPARP     SP0016887chr3:
CTexonicDe novononsynonymous SNVNM_001184717
15.921.0E-4Feliciano2019 E
AP5Z1     SP0028260chr7:
CTexonicDe novononsynonymous SNVNM_014855c.C1066Tp.R356W14.537.278E-5Feliciano2019 E
ECT2L     SP0039355chr6:
GAexonicDe novononsynonymous SNVNM_001195037
15.726.642E-5Feliciano2019 E
UTP11     SP0036966chr1:
AGexonicDe novononsynonymous SNVNM_016037c.A206Gp.K69R13.319.923E-5Feliciano2019 E
SERPINA5     SP0046854chr14:
CTexonicDe novononsynonymous SNVNM_000624c.C61Tp.R21C13.268.32E-5Feliciano2019 E
TUB     SP0018345chr11:
ACexonicDe novononsynonymous SNVNM_177972
27.43.0E-4Feliciano2019 E
TREH     SP0001365chr11:
CTexonicDe novounknown12.343.0E-4Feliciano2019 E
TEDC1     SP0041178chr14:
CTexonicDe novononsynonymous SNVNM_001134876
9.4757.0E-4Feliciano2019 E
CPZ     SP0020948chr4:
GAexonicDe novononsynonymous SNVNM_003652
33.04.0E-4Feliciano2019 E
PHF14     SP0001365chr7:
GAexonicDe novononsynonymous SNVNM_014660c.G997Ap.A333T13.292.0E-4Feliciano2019 E
LRP4     SP0032848chr11:
CTexonicDe novononsynonymous SNVNM_002334c.G5513Ap.R1838Q23.71.0E-4Feliciano2019 E
ARID1A     SP0034419chr1:
CTexonicDe novononsynonymous SNVNM_006015
14.03.0E-4Feliciano2019 E
ALS2CL     SP0000854chr3:
AGexonicDe novononsynonymous SNVNM_001190707
6.4563.0E-4Feliciano2019 E
ADCY10     SP0000665chr1:
TCexonicDe novononsynonymous SNVNM_001167749
9.994-Feliciano2019 E
ZIM2     SP0000404chr19:
TCexonicDe novononsynonymous SNVNM_015363
10.37-Feliciano2019 E
SOCS7     SP0000978chr17:
CTexonicDe novononsynonymous SNVNM_014598c.C259Tp.P87S8.353-Feliciano2019 E
BARD1     SP0000759chr2:
TAexonicDe novononsynonymous SNVNM_001282543
18.53-Feliciano2019 E
CCL13     SP0000085chr17: