or
or
Exact

Results for "KCNB2"

Variant Events: 27

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KCNB2     1-0197-003chr8:
73763368-73763368
AACGTCintronicDe novo--Yuen2017 G
KCNB2     7-0068-003chr8:
73784119-73784119
AGintronicDe novo--Yuen2017 G
KCNB2     2-1255-003chr8:
73632150-73632150
TCintronicDe novo--Yuen2017 G
KCNB2     1-0447-003chr8:
73563379-73563379
GAintronicDe novo--Yuen2017 G
KCNB2     AU4149301chr8:
73604285-73604285
CTintronicDe novo--Yuen2017 G
KCNB2     7-0256-003chr8:
73568688-73568703
AAATAATAATAATAATAAATAATAATAATintronicDe novo--Yuen2017 G
KCNB2     1-0591-003chr8:
73471242-73471256
CAGAGAGAGAGAGAGCAGAGAGAGAGAGintronicDe novo--Yuen2017 G
KCNB2     2-0272-004chr8:
73574955-73574955
GTintronicDe novo--Yuen2017 G
KCNB2     2-1436-003chr8:
73599836-73599836
TCintronicDe novo--Yuen2017 G
KCNB2     1-0138-004chr8:
73613647-73613647
TCintronicDe novo--Yuen2017 G
KCNB2     1-0299-003chr8:
73763368-73763368
AACGTCintronicDe novo--Yuen2017 G
KCNB2     AU018010chr8:
73898021-73898021
GAintergenicDe novo--Yuen2017 G
KCNB2     5-0129-003chr8:
73763368-73763368
AACGTCintronicDe novo--Yuen2017 G
KCNB2     2-0012-004chr8:
73544186-73544186
ACintronicDe novo--Yuen2017 G
KCNB2     1-0433-003chr8:
73613329-73613329
CAintronicDe novo--Yuen2017 G
KCNB2     2-0012-004chr8:
73543075-73543076
ACAintronicDe novo--Yuen2017 G
KCNB2     AU047704chr8:
73527076-73527076
GAintronicDe novo--Yuen2017 G
KCNB2     2-1380-003chr8:
73467349-73467349
GAintronicDe novo--Yuen2016 G
Yuen2017 G
KCNB2     A16chr8:
73808714-73808714
GTintronicDe novo--Wu2018 G
KCNB2     AU071204chr8:
73500684-73500684
GAintronicDe novo--Yuen2017 G
KCNB2     AU3051303chr8:
73585203-73585204
CTCintronicDe novo--Yuen2017 G
KCNB2     14482.p1chr8:
73675084-73675084
ATintronicDe novo--Turner2016 G
KCNB2     2-0215-003chr8:
73910987-73910987
GAintergenicDe novo--Yuen2017 G
KCNB2     AU1635302chr8:
73630614-73630614
GAintronicDe novo--Yuen2017 G
KCNB2     Cukier2014:3836chr8:
73849256-73849256
CTexonicUnknownnonsynonymous SNVNM_004770c.C1666Tp.P556S1.4881.0E-4Cukier2014 E
KCNB2     2-1169-003chr8:
73778703-73778703
ACintronicDe novo--Yuen2017 G
KCNB2     Cukier2014:17678chr8:
73850175-73850175
AGexonicUnknownnonsynonymous SNVNM_004770c.A2585Gp.N862S16.452.0E-4Cukier2014 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More