or
or
Exact

Results for "ABLIM2"

Variant Events: 22

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ABLIM2     2-0272-004chr4:
8053148-8053148
GGTGGTintronicDe novo--Yuen2017 G
ABLIM2     2-1416-003chr4:
8185025-8185025
CTintergenicDe novo--Yuen2017 G
ABLIM2     2-1581-003chr4:
7978283-7978283
GAintronicDe novo--Yuen2017 G
ABLIM2     1-0282-003chr4:
8053148-8053148
GGTGGTintronicDe novo--Yuen2017 G
ABLIM2     2-0272-003chr4:
8053148-8053148
GGTGGTintronicDe novo--Yuen2017 G
ABLIM2     2-1164-003chr4:
8182864-8182877
CTGTGTGTGTGTGTCTGTGTGTGTGTintergenicDe novo--Yuen2017 G
ABLIM2     2-1738-003chr4:
8151687-8151687
CTintronicDe novo--Yuen2017 G
ABLIM2     2-0003-003chr4:
8134125-8134125
GCintronicDe novo--Yuen2017 G
ABLIM2     5-0030-003chr4:
8075150-8075156
GTGGCTTGintronicDe novo--Yuen2017 G
ABLIM2     A13chr4:
8130989-8130989
GAintronicDe novo--Wu2018 G
ABLIM2     1-0006-003chr4:
8118893-8118893
ATintronicDe novo--Yuen2017 G
ABLIM2     2-0129-005chr4:
8073591-8073591
TCUTR5De novo--Yuen2017 G
ABLIM2     2-1619-003chr4:
8165639-8165639
CGintergenicDe novo--Yuen2017 G
ABLIM2     2-1223-003chr4:
7992927-7992932
CCTTCTCCTintronicDe novo--Yuen2017 G
ABLIM2     AU4223302chr4:
8025942-8025942
GAintronicDe novo--Yuen2017 G
ABLIM2     1-0339-004chr4:
8116796-8116796
CAintronicDe novo--Yuen2017 G
ABLIM2     AU2140305chr4:
8136133-8136133
GAintronicDe novo--Yuen2017 G
ABLIM2     1-0043-003chr4:
7968976-7968976
CGintronicDe novo--Yuen2017 G
ABLIM2     2-1246-003chr4:
8050332-8050332
GAintronicDe novo--Yuen2017 G
ABLIM2     7-0024-003chr4:
8195187-8195188
ACAintergenicDe novo--Yuen2017 G
ABLIM2     2-1206-003chr4:
8081406-8081406
GCintronicDe novo--Yuen2016 G
Yuen2017 G
ABLIM2     AU4069301chr4:
8098524-8098524
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More