or
or
Exact

Results for "ALX1"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ALX1     Li2017:16185chr12:
85677521-85677521
GAexonicUnknownnonsynonymous SNVNM_006982c.G398Ap.R133Q33.08.237E-6Li2017 T
ALX1     2-1382-003chr12:
85887499-85887499
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
ALX1     AU3263302chr12:
85680305-85680305
GAintronicDe novo--Yuen2017 G
ALX1     AU3858303chr12:
86057808-86057808
CGintergenicDe novo--Yuen2017 G
ALX1     AU4233301chr12:
85844848-85844848
GAintergenicDe novo--Yuen2017 G
ALX1     AU2140305chr12:
86073129-86073129
GAintergenicDe novo--Yuen2017 G
ALX1     1-0191-003chr12:
86129177-86129177
GTintergenicDe novo--Yuen2017 G
ALX1     1-0638-003chr12:
85963662-85963662
GAintergenicDe novo--Yuen2017 G
ALX1     A17chr12:
85675539-85675539
TCintronicDe novo--Wu2018 G
ALX1     1-0568-003chr12:
86167602-86167605
CATTCintergenicDe novo--Yuen2017 G
ALX1     7-0024-005chr12:
85925757-85925757
TAintergenicDe novo--Yuen2017 G
ALX1     AU1725306chr12:
86173322-86173322
GAintergenicDe novo--Yuen2017 G
ALX1     1-0395-004chr12:
86172452-86172452
TAintergenicDe novo--Yuen2017 G
ALX1     AU024606chr12:
85878623-85878623
TGintergenicDe novo--Yuen2017 G
ALX1     7-0127-003chr12:
86192939-86192939
TCintergenicDe novo--Yuen2017 G
ALX1     2-1299-003chr12:
86011916-86011916
TGintergenicDe novo--Yuen2017 G
ALX1     5-0095-003chr12:
85947459-85947473
CTATATATATATATACTATATATATATAintergenicDe novo--Yuen2017 G
ALX1     AU2000302chr12:
85720986-85720986
CTintergenicDe novo--Yuen2017 G
ALX1     2-0208-003chr12:
86088017-86088017
AGintergenicDe novo--Yuen2017 G
ALX1     5-0061-003chr12:
85806559-85806559
CTintergenicDe novo--Yuen2017 G
ALX1     SP0026759chr12:
85674110-85674110
CTexonicDe novononsynonymous SNVNM_006982c.C71Tp.A24V17.58-Feliciano2019 E
ALX1     1-0898-003chr12:
85705865-85705865
CTintergenicDe novo--Yuen2017 G
ALX1     7-0251-003chr12:
86135528-86135528
AGintergenicDe novo--Yuen2017 G
ALX1     AU043804chr12:
86085227-86085227
TCintergenicDe novo--Yuen2017 G
ALX1     7-0219-003chr12:
85864439-85864439
TCintergenicDe novo--Yuen2017 G
ALX1     1-0025-004chr12:
85760478-85760478
AGintergenicDe novo--Yuen2017 G
ALX1     AU4197301chr12:
85887787-85887787
GCintergenicDe novo--Yuen2017 G
ALX1     1-0010-005chr12:
86114560-86114560
AATGintergenicDe novo--Yuen2017 G
ALX1     1-0640-003chr12:
85819169-85819169
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More