or
or
Exact

Results for "MANEA"

Variant Events: 26

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MANEA     AU3806304chr6:
96444068-96444068
AGintergenicDe novo--Yuen2017 G
MANEA     2-1138-003chr6:
96421630-96421630
CTintergenicDe novo--Yuen2017 G
MANEA     2-1511-003chr6:
96101017-96101017
ATintergenicDe novo--Yuen2017 G
MANEA     1-0708-003chr6:
96025980-96025980
GCintronicDe novo--Yuen2017 G
MANEA     7-0129-003chr6:
96111960-96111960
CTintergenicDe novo--Yuen2017 G
MANEA     AU2000302chr6:
96242878-96242878
GCintergenicDe novo--Yuen2017 G
MANEA     AU2988302chr6:
96102716-96102716
CTintergenicDe novo--Yuen2017 G
MANEA     AU2988302chr6:
96103430-96103430
GCintergenicDe novo--Yuen2017 G
MANEA     AU3517302chr6:
96281345-96281345
TGintergenicDe novo--Yuen2017 G
MANEA     2-1246-003chr6:
96328215-96328215
TGintergenicDe novo--Yuen2017 G
MANEA     2-1632-003chr6:
96280129-96280129
TCintergenicDe novo--Yuen2017 G
MANEA     AU011021chr6:
96086074-96086074
CAintergenicDe novo--Yuen2017 G
MANEA     AU2988303chr6:
96102716-96102716
CTintergenicDe novo--Yuen2017 G
MANEA     AU2988303chr6:
96103430-96103430
GCintergenicDe novo--Yuen2017 G
MANEA     3-0437-000chr6:
96378352-96378371
TACTAGTGAACAGAAACACCTintergenicDe novo--Yuen2016 G
MANEA     5-0050-003chr6:
96371435-96371435
TCintergenicDe novo--Yuen2017 G
MANEA     iHART1915chr6:
96034466-96034466
CTexonicPaternalstopgainNM_024641c.C151Tp.R51X16.884.949E-5Ruzzo2019 G
MANEA     1-0965-003chr6:
96109320-96109320
GAintergenicDe novo--Yuen2017 G
MANEA     2-1292-003chr6:
96328215-96328215
TGintergenicDe novo--Yuen2017 G
MANEA     3-0456-000chr6:
96449791-96449791
GAintergenicDe novo--Yuen2016 G
MANEA     A17chr6:
96327891-96327891
TAintergenicDe novo--Wu2018 G
MANEA     AU0636303chr6:
96100937-96100937
TCintergenicDe novo--Yuen2017 G
MANEA     2-1164-003chr6:
96076623-96076631
TAAAAAAAATAAAAAAintergenicDe novo--Yuen2017 G
MANEA     1-0075-003chr6:
96207899-96207899
GCintergenicDe novo--Yuen2017 G
MANEA     AU017304chr6:
96189175-96189175
GCintergenicDe novo--Yuen2017 G
MANEA     AU2117302chr6:
96266878-96266878
ATintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More