or
or
Exact

Results for "GALNT17"

Variant Events: 37

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GALNT17     AU3729303chr7:
71038307-71038309
ATTATintronicDe novo--Yuen2017 G
GALNT17     2-1313-003chr7:
71200682-71200687
TAAATATintergenicDe novo--Yuen2016 G
GALNT17     AU036203chr7:
70629593-70629593
AGintronicDe novo--Yuen2017 G
GALNT17     A9chr7:
71064664-71064664
GAintronicDe novo--Wu2018 G
GALNT17     12859.p1chr7:
71130451-71130451
TCexonicDe novononsynonymous SNVNM_022479c.T1136Cp.I379T26.91.648E-5Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
GALNT17     AU3727303chr7:
71074401-71074401
TCintronicDe novo--Yuen2017 G
GALNT17     A16chr7:
70886222-70886222
GAintronicDe novo--Wu2018 G
GALNT17     AU065807chr7:
70962442-70962442
CGintronicDe novo--Yuen2017 G
GALNT17     7-0254-004chr7:
70736040-70736040
CTintronicDe novo--Yuen2017 G
GALNT17     AU062204chr7:
70784086-70784086
TAintronicDe novo--Yuen2017 G
GALNT17     2-1086-003chr7:
71242745-71242745
GAintergenicDe novo--Yuen2017 G
GALNT17     AU1795303chr7:
70860768-70860768
TCintronicDe novo--Yuen2017 G
GALNT17     5-0054-003chr7:
70847687-70847687
GAintronicDe novo--Yuen2017 G
GALNT17     5-0099-003chr7:
70693277-70693277
TCintronicDe novo--Yuen2017 G
GALNT17     AU3907302chr7:
70638254-70638254
CAintronicDe novo--Yuen2017 G
GALNT17     SSC06092chr7:
71130451-71130451
TCexonicDe novononsynonymous SNVNM_022479c.T1136Cp.I379T26.91.648E-5Lim2017 E
GALNT17     2-1173-003chr7:
71017670-71017670
GAintronicDe novo--Yuen2017 G
GALNT17     AU024004chr7:
70835695-70835695
CAintronicDe novo--Yuen2017 G
GALNT17     AU4072303chr7:
70680280-70680291
CTTGTTGTTGTTCTTGTTGTTintronicDe novo--Yuen2017 G
GALNT17     1-0559-005chr7:
70817394-70817395
TGTintronicDe novo--Yuen2017 G
GALNT17     2-1117-003chr7:
71120447-71120447
CTintronicDe novo--Yuen2016 G
Yuen2017 G
GALNT17     2-1709-003chr7:
70741997-70741997
TGintronicDe novo--Yuen2017 G
GALNT17     5-0030-003chr7:
70604935-70604935
GAintronicDe novo--Yuen2017 G
GALNT17     1-0495-003chr7:
70995318-70995345
AACACACACACACACGCACACACACACAAACACACACACACGCACACACACACAintronicDe novo--Yuen2017 G
GALNT17     AU3913302chr7:
70740369-70740369
TCintronicDe novo--Yuen2017 G
GALNT17     AU4310301chr7:
70938263-70938263
TAintronicDe novo--Yuen2017 G
GALNT17     12547.p1chr7:
71130393-71130393
TCintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
GALNT17     14501.p1chr7:
71130575-71130575
GAexonicDe novosynonymous SNVNM_022479c.G1260Ap.P420P-6.0E-4Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
GALNT17     1-0024-003chr7:
71159225-71159225
CTintronicDe novo--Yuen2017 G
GALNT17     1-0051-004chr7:
71010311-71010311
GAintronicDe novo--Yuen2017 G
GALNT17     1-0568-003chr7:
71098054-71098054
AACTintronicDe novo--Yuen2017 G
GALNT17     1-0671-003chr7:
71243046-71243046
CTintergenicDe novo--Yuen2017 G
GALNT17     2-1325-003chr7:
70897738-70897738
ACintronicDe novo--Yuen2017 G
GALNT17     AU1635302chr7:
71126165-71126165
GTintronicDe novo--Yuen2017 G
GALNT17     AU3605304chr7:
71206098-71206098
AGintergenicDe novo--Yuen2017 G
GALNT17     2-1291-003chr7:
70973708-70973708
GAintronicDe novo--Yuen2016 G
Yuen2017 G
GALNT17     2-1341-004chr7:
71148947-71148947
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More