or
or
Exact

Results for "ROBO1"

Variant Events: 156

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ROBO1     2-1269-003chr3:
80242268-80242268
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
ROBO1     A18chr3:
79195594-79195594
TCintronicDe novo--Wu2018 G
ROBO1     2-1626-003chr3:
78724926-78724926
CTintronicDe novo--Yuen2017 G
ROBO1     13171.p1chr3:
79584224-79584224
TCintronicDe novo--Turner2016 G
ROBO1     AU0540301chr3:
79149533-79149533
CGintronicDe novo--Yuen2017 G
ROBO1     AU3907302chr3:
78727478-78727478
GAintronicDe novo--Yuen2017 G
ROBO1     12529.p1chr3:
80859122-80859122
GAintergenicDe novo--Turner2016 G
ROBO1     13023.p1chr3:
78993524-78993524
TCintronicDe novo--Turner2016 G
ROBO1     A13chr3:
78990753-78990753
AGintronicDe novo--Wu2018 G
ROBO1     2-1322-004chr3:
79102725-79102725
CTintronicDe novo--Yuen2017 G
ROBO1     AU4079301chr3:
80352934-80352941
TTTTGTTTTTTTGTTTGTTTintergenicDe novo--Yuen2017 G
ROBO1     AU3912301chr3:
79984266-79984273
GTTTTTTTGTTTTTTintergenicDe novo--Yuen2017 G
ROBO1     2-0210-005chr3:
80116818-80116818
CTintergenicDe novo--Yuen2017 G
ROBO1     AU3263301chr3:
80666814-80666814
AGintergenicDe novo--Yuen2017 G
ROBO1     PN400439chr3:
78683723-78683724
CTCintronicUnknown-2.0E-4Leblond2019 E
ROBO1     1-0054-004chr3:
80859061-80859061
AGintergenicDe novo--Yuen2017 G
ROBO1     AU2495302chr3:
80153821-80153821
TCintergenicDe novo--Yuen2017 G
ROBO1     PN400306chr3:
78683723-78683724
CTCintronicUnknown-2.0E-4Leblond2019 E
ROBO1     1-0571-003chr3:
79851499-79851499
GAintergenicDe novo--Yuen2017 G
ROBO1     1-0388-003chr3:
79439743-79439743
GAintronicDe novo--Yuen2017 G
ROBO1     1-0530-003chr3:
79399043-79399043
TCintronicDe novo--Yuen2016 G
Yuen2017 G
ROBO1     1-0447-003chr3:
80411061-80411067
CAAAAAACAAAAAintergenicDe novo--Yuen2017 G
ROBO1     2-0110-003chr3:
78650502-78650502
CTintronicDe novo--Yuen2016 G
Yuen2017 G
ROBO1     5-0110-003chr3:
80068040-80068040
AGintergenicDe novo--Yuen2017 G
ROBO1     AU2793303chr3:
80343611-80343611
ATintergenicDe novo--Yuen2017 G
ROBO1     1-0080-003chr3:
80037855-80037855
CAintergenicDe novo--Yuen2017 G
ROBO1     2-1455-003chr3:
79711668-79711668
CTintronicDe novo--Yuen2016 G
Yuen2017 G
ROBO1     AU039305chr3:
78866582-78866582
TAintronicDe novo--Yuen2017 G
ROBO1     2-0289-004chr3:
80696671-80696679
AAAAGCATCAintergenicDe novo--Yuen2017 G
ROBO1     2-1212-003chr3:
79683432-79683432
CTintronicDe novo--Yuen2017 G
ROBO1     1-0112-003chr3:
79500311-79500316
AAAGTCAintronicDe novo--Yuen2017 G
ROBO1     PN400119chr3:
78717701-78717702
ACAexonicUnknownframeshift deletionNM_001145845
NM_133631
NM_002941
c.1454delG
c.1454delG
c.1562delG
p.G485fs
p.G485fs
p.G521fs
--Leblond2019 E
ROBO1     2-1323-003chr3:
79456521-79456521
GAintronicDe novo--Yuen2016 G
Yuen2017 G
ROBO1     AU4032306chr3:
78683003-78683003
CTintronicDe novo--Yuen2017 G
ROBO1     AU4032306chr3:
80036703-80036703
ATintergenicDe novo--Yuen2017 G
ROBO1     AU4231301chr3:
79441600-79441605
GAAAAAGAAAAAAintronicDe novo--Yuen2017 G
ROBO1     2-1617-003chr3:
80699914-80699914
CTintergenicDe novo--Yuen2017 G
ROBO1     1-0272-004chr3:
80047470-80047470
ATintergenicDe novo--Yuen2017 G
ROBO1     AU2029302chr3:
81038402-81038402
GAintergenicDe novo--Yuen2017 G
ROBO1     AU3053302chr3:
80490861-80490861
CTintergenicDe novo--Yuen2017 G
ROBO1     1-0344-003chr3:
80917694-80917694
GAintergenicDe novo--Yuen2017 G
ROBO1     2-1399-003chr3:
80832742-80832747
CAAAAACAAAAAAintergenicDe novo--Yuen2017 G
ROBO1     5-0116-003chr3:
79292765-79292765
GCintronicDe novo--Yuen2017 G
ROBO1     AU4164301chr3:
80823677-80823677
TGintergenicDe novo--Yuen2017 G
ROBO1     1-0344-003chr3:
80359050-80359050
ACintergenicDe novo--Yuen2017 G
ROBO1     AU0636303chr3:
80102699-80102699
TCintergenicDe novo--Yuen2017 G
ROBO1     2-1386-003chr3:
80750170-80750170
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
ROBO1     2-1380-003chr3:
80422211-80422211
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
ROBO1     AU3951301chr3:
78726574-78726574
AGintronicDe novo--Yuen2017 G
ROBO1     AU3951301chr3:
78837591-78837591
ATintronicDe novo--Yuen2017 G
ROBO1     AU3951301chr3:
78930251-78930251
TCintronicDe novo--Yuen2017 G
ROBO1     AU057503chr3:
80834573-80834573
CAintergenicDe novo--Yuen2017 G
ROBO1     AU066818chr3:
80920737-80920737
CTintergenicDe novo--Yuen2017 G
ROBO1     AU030804chr3:
78783864-78783864
ACintronicDe novo--Yuen2017 G
ROBO1     2-0296-004chr3:
79577126-79577126
AAGACCTTGintronicDe novo--Yuen2017 G
ROBO1     AU072005chr3:
79032926-79032926
TGintronicDe novo--Yuen2017 G
ROBO1     Lee2020:84chr3:
78685067-78685067
GAexonicstopgainNM_001145845
NM_133631
NM_002941
c.C2929T
c.C3094T
c.C3229T
p.Q977X
p.Q1032X
p.Q1077X
43.0-Lee2020 T
ROBO1     1-0512-003chr3:
79589646-79589646
CTintronicDe novo--Yuen2017 G
ROBO1     1-0651-003chr3:
79917027-79917027
TCintergenicDe novo--Yuen2017 G
ROBO1     AU4462302chr3:
80021209-80021209
TCintergenicDe novo--Yuen2017 G
ROBO1     1-0218-004chr3:
80984825-80984825
GCintergenicDe novo--Yuen2017 G
ROBO1     1-0218-004chr3:
80265384-80265384
GAintergenicDe novo--Yuen2017 G
ROBO1     iHART3065chr3:
78763664-78763664
GAexonicMaternalstopgainNM_001145845
NM_133631
NM_002941
c.C811T
c.C811T
c.C928T
p.R271X
p.R271X
p.R310X
41.0-Ruzzo2019 G
ROBO1     iHART1571chr3:
78667135-78667135
TGexonicDe novononsynonymous SNVNM_001145845
NM_133631
NM_002941
c.A3632C
c.A3797C
c.A3932C
p.Y1211S
p.Y1266S
p.Y1311S
18.77-Ruzzo2019 G
ROBO1     PN400264chr3:
78683723-78683724
CTCintronicUnknown-2.0E-4Leblond2019 E
ROBO1     2-1174-006chr3:
79674388-79674388
CTintronicDe novo--Yuen2017 G
ROBO1     5-0014-004chr3:
80813377-80813377
CTintergenicDe novo--Yuen2017 G
ROBO1     1-0469-005chr3:
80846903-80846903
ACintergenicDe novo--Yuen2017 G
ROBO1     2-0036-003chr3:
81011416-81011416
ATintergenicDe novo--Yuen2016 G
ROBO1     AU036203chr3:
79324182-79324182
CTintronicDe novo--Yuen2017 G
ROBO1     AU3175303chr3:
79227086-79227086
TGintronicDe novo--Yuen2017 G
ROBO1     AU054103chr3:
80669826-80669826
GAintergenicDe novo--Yuen2017 G
ROBO1     1-0329-003chr3:
80753527-80753527
ATintergenicDe novo--Yuen2017 G
ROBO1     AU3857301chr3:
79198482-79198482
CGintronicDe novo--Yuen2017 G
ROBO1     1-0435-003chr3:
80526176-80526176
TCintergenicDe novo--Yuen2017 G
ROBO1     3-0428-000chr3:
79320381-79320381
TGintronicDe novo--Yuen2016 G
Yuen2017 G
ROBO1     AU3634301chr3:
80892852-80892852
CTintergenicDe novo--Yuen2017 G
ROBO1     1-0068-003chr3:
80509114-80509114
GAintergenicDe novo--Yuen2017 G
ROBO1     1-0863-003chr3:
78654333-78654333
GCintronicDe novo--Yuen2017 G
ROBO1     2-1297-003chr3:
79277015-79277022
GAGATACAGintronicDe novo--Yuen2017 G
ROBO1     AU1668302chr3:
79874189-79874189
CAintergenicDe novo--Yuen2017 G
ROBO1     11504.p1chr3:
80011281-80011283
CTTCintergenicDe novo--Wilfert2021 G
ROBO1     2-0145-004chr3:
79992170-79992175
GTCTTTGintergenicDe novo--Yuen2017 G
ROBO1     AU3862305chr3:
80132005-80132005
GTintergenicDe novo--Yuen2017 G
ROBO1     AU075703chr3:
79389477-79389477
ACintronicDe novo--Yuen2017 G
ROBO1     2-0011-004chr3:
80065370-80065370
CTintergenicDe novo--Yuen2017 G
ROBO1     1-0481-003chr3:
79315802-79315802
AGintronicDe novo--Yuen2017 G
ROBO1     2-1362-004chr3:
78945506-78945506
ACintronicDe novo--Yuen2017 G
ROBO1     7-0179-003chr3:
80809132-80809132
CAintergenicDe novo--Yuen2017 G
ROBO1     PN400266chr3:
78683723-78683724
CTCintronicUnknown-2.0E-4Leblond2019 E
ROBO1     AU4444304chr3:
79327813-79327813
AGintronicDe novo--Yuen2017 G
ROBO1     AU2433302chr3:
79166896-79166896
CTintronicDe novo--Yuen2017 G
ROBO1     AU3646301chr3:
79222800-79222800
CTintronicDe novo--Yuen2017 G
ROBO1     1-0720-003chr3:
79556232-79556233
ATAintronicDe novo--Yuen2017 G
ROBO1     2-0016-003chr3:
81011416-81011416
ATintergenicDe novo--Yuen2017 G
ROBO1     AU009903chr3:
80594898-80594898
AGintergenicDe novo--Yuen2017 G
ROBO1     2-1094-005chr3:
79637200-79637200
AGintronicDe novo--Yuen2017 G
ROBO1     2-1360-003chr3:
78825748-78825748
CTintronicDe novo--Yuen2016 G
Yuen2017 G
ROBO1     1-0112-004chr3:
79500311-79500316
AAAGTCAintronicDe novo--Yuen2017 G
ROBO1     2-1341-004chr3:
80983251-80983251
GAintergenicDe novo--Yuen2017 G
ROBO1     2-1398-003chr3:
80344364-80344368
GATACGintergenicDe novo--Yuen2017 G
ROBO1     7-0119-003chr3:
79574561-79574561
CTintronicDe novo--Yuen2017 G
ROBO1     1-0923-003chr3:
79959862-79959862
TCintergenicDe novo--Yuen2017 G
ROBO1     AU2109302chr3:
79420402-79420402
GTintronicDe novo--Yuen2017 G
ROBO1     2-0503-004chr3:
79484448-79484448
CGintronicDe novo--Yuen2017 G
ROBO1     AU1404302chr3:
79547830-79547830
CGintronicDe novo--Yuen2017 G
ROBO1     AU2029303chr3:
81038402-81038402
GAintergenicDe novo--Yuen2017 G
ROBO1     2-1269-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
ROBO1     2-1408-004chr3:
79758787-79758787
TCintronicDe novo--Yuen2017 G
ROBO1     AU015903chr3:
78671110-78671110
CTintronicDe novo--Yuen2017 G
ROBO1     AU3913303chr3:
80016069-80016069
TAintergenicDe novo--Yuen2017 G
ROBO1     AU4012302chr3:
79718538-79718538
TCintronicDe novo--Yuen2017 G
ROBO1     1-0347-003chr3:
79788742-79788742
TGintronicDe novo--Yuen2017 G
ROBO1     AU015903chr3:
80947314-80947314
CTintergenicDe novo--Yuen2017 G
ROBO1     2-1382-003chr3:
79172491-79172491
GAintronicDe novo--Yuen2016 G
Yuen2017 G
ROBO1     2-1440-003chr3:
79307097-79307097
TCintronicDe novo--Yuen2016 G
Yuen2017 G
ROBO1     A31chr3:
79541264-79541264
CTintronicDe novo--Wu2018 G
ROBO1     1-0534-004chr3:
81039875-81039875
TGintergenicDe novo--Yuen2017 G
ROBO1     AU1725306chr3:
79403355-79403355
TAintronicDe novo--Yuen2017 G
ROBO1     AU3371305chr3:
78719129-78719129
TCintronicDe novo--Yuen2017 G
ROBO1     AU3839303chr3:
78919972-78919972
AGintronicDe novo--Yuen2017 G
ROBO1     AU4463303chr3:
80796811-80796811
GCintergenicDe novo--Yuen2017 G
ROBO1     2-1605-004chr3:
80003259-80003259
GTintergenicDe novo--Yuen2017 G
ROBO1     5-0077-003chr3:
80762290-80762290
CTintergenicDe novo--Yuen2017 G
ROBO1     1-0393-003chr3:
80426961-80426963
CAACAintergenicDe novo--Yuen2017 G
ROBO1     1-0627-003chr3:
80361858-80361858
CTintergenicDe novo--Yuen2017 G
ROBO1     AU3779304chr3:
80152566-80152566
TCintergenicDe novo--Yuen2017 G
ROBO1     2-1579-003chr3:
80821753-80821753
GTintergenicDe novo--Yuen2017 G
ROBO1     AU3506303chr3:
80841133-80841133
GAintergenicDe novo--Yuen2017 G
ROBO1     AU066104chr3:
79730378-79730378
CAintronicDe novo--Yuen2017 G
ROBO1     AU3951302chr3:
79909954-79909954
CTintergenicDe novo--Yuen2017 G
ROBO1     1-0901-003chr3:
80750817-80750817
TCintergenicDe novo--Yuen2017 G
ROBO1     2-1297-004chr3:
79277015-79277022
GAGATACAGintronicDe novo--Yuen2017 G
ROBO1     1-0901-003chr3:
79645088-79645088
CAintronicDe novo--Yuen2017 G
ROBO1     AU2072302chr3:
80238971-80238971
TCintergenicDe novo--Yuen2017 G
ROBO1     1-0559-005chr3:
80969108-80969108
ATintergenicDe novo--Yuen2017 G
ROBO1     2-1371-003chr3:
80798712-80798728
TATAATAATAATAATAATATAATAATAATAAintergenicDe novo--Yuen2017 G
ROBO1     1-0219-003chr3:
80314996-80314996
GCintergenicDe novo--Yuen2017 G
ROBO1     2-1375-003chr3:
79119862-79119862
CAintronicDe novo--Yuen2016 G
Yuen2017 G
ROBO1     2-1350-003chr3:
79050953-79050953
CAintronicDe novo--Yuen2017 G
ROBO1     2-1174-005Bchr3:
79674388-79674388
CTintronicDe novo--Yuen2017 G
ROBO1     5-0123-003chr3:
80516044-80516044
CTintergenicDe novo--Yuen2017 G
ROBO1     2-0289-003chr3:
80696671-80696679
AAAAGCATCAintergenicDe novo--Yuen2017 G
ROBO1     AU2569301chr3:
80256403-80256406
ATTTATTintergenicDe novo--Yuen2017 G
ROBO1     5-0040-003chr3:
79282312-79282312
GAintronicDe novo--Yuen2017 G
ROBO1     SSC06268chr3:
78685134-78685134
AGexonicDe novosynonymous SNVNM_133631
NM_002941
c.T3027C
c.T3162C
p.N1009N
p.N1054N
--Lim2017 E
ROBO1     1-0593-003chr3:
78854194-78854194
GAintronicDe novo--Yuen2017 G
ROBO1     1-0965-003chr3:
80042968-80042968
AGintergenicDe novo--Yuen2017 G
ROBO1     2-0319-003chr3:
80520118-80520118
TTCATCAintergenicDe novo--Yuen2017 G
ROBO1     12976.p1chr3:
78685134-78685134
AGexonicDe novosynonymous SNVNM_133631
NM_002941
c.T3027C
c.T3162C
p.N1009N
p.N1054N
--Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
ROBO1     2-1398-004chr3:
80344364-80344368
GATACGintergenicDe novo--Yuen2017 G
ROBO1     2-1526-003chr3:
79445409-79445428
ATATTTGAGGTTTTTGATAGAintronicDe novo--Yuen2017 G
ROBO1     AU0780301chr3:
79520307-79520307
GAintronicDe novo--Yuen2017 G
ROBO1     1-0387-003 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
ROBO1     2-0081-003chr3:
79245324-79245324
AGintronicDe novo--Yuen2017 G
ROBO1     AU2029301chr3:
80403880-80403880
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More