or
or
Exact

Results for "SLC7A14"

Variant Events: 20

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SLC7A14     A16chr3:
170364444-170364444
AGintergenicDe novo--Wu2018 G
SLC7A14     7-0024-005chr3:
170226639-170226639
GAintronicDe novo--Yuen2017 G
SLC7A14     2-0256-004chr3:
170423531-170423531
CTintergenicDe novo--Yuen2017 G
SLC7A14     1-0513-003chr3:
170526030-170526030
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
SLC7A14     2-0022-003chr3:
170236132-170236132
TCintronicDe novo--Yuen2017 G
SLC7A14     1-0231-004chr3:
170274312-170274324
ATAGTAGGGTTTTAintronicDe novo--Yuen2017 G
SLC7A14     AU4188302chr3:
170286274-170286274
CTintronicDe novo--Yuen2017 G
SLC7A14     AU025704chr3:
170445655-170445655
CTintergenicDe novo--Yuen2017 G
SLC7A14     AU3905301chr3:
170257818-170257818
GAintronicDe novo--Yuen2017 G
SLC7A14     1-0572-003chr3:
170578564-170578576
CCTCTCTCTCTCTCCTCTCTCTCTintergenicDe novo--Yuen2017 G
SLC7A14     iHART2244chr3:
170201176-170201176
CCTexonicMaternalframeshift insertionNM_020949c.1041dupAp.V348fs--Ruzzo2019 G
SLC7A14     AU060403chr3:
170283487-170283487
ACintronicDe novo--Yuen2017 G
SLC7A14     AU3853302chr3:
170339948-170339948
CTintergenicDe novo--Yuen2017 G
SLC7A14     2-1434-003chr3:
170333090-170333098
CTTTTTTTTCTTTTTTintergenicDe novo--Yuen2017 G
SLC7A14     1-0019-004chr3:
170565917-170565917
GGCCCCAintergenicDe novo--Yuen2017 G
SLC7A14     1-0547-003chr3:
170532810-170532843
ATCTCTCTCTCTCTCTGTCTCTCTCTCTCTCTCTATCTCTCTCTCTCTGTCTCTCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
SLC7A14     AU1308303chr3:
170244076-170244076
AGintronicDe novo--Yuen2017 G
SLC7A14     2-1313-003chr3:
170510372-170510372
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
SLC7A14     5-0147-003chr3:
170198367-170198367
GAexonicDe novosynonymous SNVNM_020949c.C1704Tp.C568C-9.063E-5Yuen2017 G
SLC7A14     AU3794302chr3:
170221846-170221846
ATintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More