or
or
Exact

Results for "MICAL3"

Variant Events: 23

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MICAL3     AU3885305chr22:
18441221-18441221
CAintronicDe novo--Yuen2017 G
MICAL3     AU4263304chr22:
18341466-18341466
GTintronicDe novo--Yuen2017 G
MICAL3     2-0215-003chr22:
18407996-18407996
GAintronicDe novo--Yuen2017 G
MICAL3     10C105014chr22:
18387403-18387403
TCexonicDe novononsynonymous SNVNM_001122731
NM_001136004
NM_015241
c.A467G
c.A467G
c.A467G
p.H156R
p.H156R
p.H156R
24.7-Satterstrom2020 E
MICAL3     1-0125-003chr22:
18304070-18304071
GCGCCintronicDe novo--Yuen2017 G
MICAL3     PN400457chr22:
18300290-18300290
TAexonicUnknownstopgainNM_015241c.A5137Tp.K1713X49.0-Leblond2019 E
MICAL3     1-0024-003chr22:
18486083-18486083
CTintronicDe novo--Yuen2016 G
Yuen2017 G
MICAL3     2-1441-003chr22:
18294655-18294655
CTintronicDe novo--Yuen2016 G
Yuen2017 G
MICAL3     A13chr22:
18475295-18475295
TCintronicDe novo--Wu2018 G
MICAL3     1-0285-003chr22:
18273122-18273122
CTUTR3De novo--Yuen2017 G
MICAL3     2-0202-003chr22:
18394633-18394633
AAGCTTAGATGAAAAATGintronicDe novo--Yuen2017 G
MICAL3     AU047703chr22:
18311700-18311700
CAintronicDe novo--Yuen2017 G
MICAL3     08C72495chr22:
18314763-18314763
GAexonicDe novononsynonymous SNVNM_015241c.C2912Tp.A971V10.7-Satterstrom2020 E
MICAL3     1-0871-003chr22:
18321211-18321211
GAintronicDe novo--Yuen2017 G
MICAL3     PN400259chr22:
18300290-18300290
TAexonicUnknownstopgainNM_015241c.A5137Tp.K1713X49.0-Leblond2019 E
MICAL3     152311chr22:
18378069-18378069
TCexonicDe novononsynonymous SNVNM_001122731
NM_001136004
NM_015241
c.A1430G
c.A1430G
c.A1430G
p.N477S
p.N477S
p.N477S
9.0321.735E-5Satterstrom2020 E
MICAL3     2-1237-003chr22:
18272111-18272111
GCUTR3De novo--Yuen2017 G
MICAL3     2-1363-003chr22:
18387403-18387403
TCexonicDe novononsynonymous SNVNM_001122731
NM_001136004
NM_015241
c.A467G
c.A467G
c.A467G
p.H156R
p.H156R
p.H156R
24.7-Jiang2013 G
Yuen2016 G
Yuen2017 G
MICAL3     AU003406chr22:
18486095-18486095
GAintronicDe novo--Yuen2017 G
MICAL3     AU3634301chr22:
18498667-18498667
GCintronicDe novo--Yuen2017 G
MICAL3     2-1620-003chr22:
18462183-18462183
CTintronicDe novo--Yuen2017 G
MICAL3     5-0140-003chr22:
18359964-18360134
GGGAGGTTATGGAGGTTATGGAGGTTAGGGAGGTTATGGAGGTTAGGGAGGTTAGGGAGGTTAGGGAAGTTATGGAGGTTAGGGAGGTTATGGAGGTTAGGGAGGTTATGGAGGTTAGGGAGGTTAGGGAGGTTATGGAGGTTAGGGAGGTTAGGGAGGTTATGGAGGTTAGGGAGGTTATGGAGGTTAGGGAGGTTATGGAGGTTAGGGAGGTTAGGGAGGTTAGGGAAGTTATGGAGGTTAGGGAGGTTATGGAGGTTAGGGAGGTTATGGAGGTTAGGGAGGTTAGGGAGGTTATGGAGGTTAGGGAGGTTAGGGAGGTTATGGAGGTTAintronicDe novo--Yuen2017 G
MICAL3     AU2129303chr22:
18271417-18271417
AGUTR3De novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More