or
or
Exact

Results for "SORCS2"

Variant Events: 45

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SORCS2     2-0225-004chr4:
7505226-7505226
GGAGACAGAGACGGAGACATAGAGGGGCAGAGACATintronicDe novo--Yuen2017 G
SORCS2     2-0298-003chr4:
7449798-7449798
TCintronicDe novo--Yuen2017 G
SORCS2     7-0001-003chr4:
7593208-7593208
GAintronicDe novo--Yuen2017 G
SORCS2     7-0082-003chr4:
7641332-7641332
GAintronicDe novo--Yuen2017 G
SORCS2     2-1235-003chr4:
7579206-7579206
GAintronicDe novo--Yuen2017 G
SORCS2     A15chr4:
7746159-7746159
GCintergenicDe novo--Wu2018 G
SORCS2     2-1382-003chr4:
7495731-7495744
AACACACACACACAAACACACACACAintronicDe novo--Yuen2017 G
SORCS2     1-0627-007chr4:
7451634-7451634
CTintronicDe novo--Yuen2017 G
SORCS2     2-1452-003chr4:
7668362-7668362
ACintronicDe novo--Yuen2016 G
Yuen2017 G
SORCS2     AU3900302chr4:
7319199-7319199
CAintronicDe novo--Yuen2017 G
SORCS2     7-0254-004chr4:
7265627-7265627
CTintronicDe novo--Yuen2017 G
SORCS2     AU046708chr4:
7720958-7720958
TCintronicDe novo--Yuen2017 G
SORCS2     1-0569-003chr4:
7678745-7678759
CCTCTCTCTCTCTCTCCTCTCTCTCTCTintronicDe novo--Yuen2017 G
SORCS2     A21chr4:
7478554-7478554
CTintronicDe novo--Wu2018 G
SORCS2     1-0148-005chr4:
7649211-7649211
CAintronicDe novo--Yuen2017 G
SORCS2     2-0278-003chr4:
7451356-7451356
TCintronicDe novo--Yuen2017 G
SORCS2     1-0025-004chr4:
7643746-7643746
AATGGGGATGAATGGATTGATGGGTGGGTGGGTGGATGGATGGGintronicDe novo--Yuen2017 G
SORCS2     AU049304chr4:
7342555-7342555
CTintronicDe novo--Yuen2017 G
SORCS2     AU3053302chr4:
7252940-7252940
GAintronicDe novo--Yuen2017 G
SORCS2     AU3955303chr4:
7665113-7665113
CGintronicDe novo--Yuen2017 G
SORCS2     1-0261-004chr4:
7600232-7600232
ACintronicDe novo--Yuen2017 G
SORCS2     2-1297-004chr4:
7611415-7611415
CTintronicDe novo--Yuen2017 G
SORCS2     1-0454-003chr4:
7565215-7565215
TCintronicDe novo--Yuen2017 G
SORCS2     AU3951302chr4:
7319112-7319112
GAintronicDe novo--Yuen2017 G
SORCS2     1-0025-006chr4:
7485067-7485070
AGACAintronicDe novo--Yuen2017 G
SORCS2     A12chr4:
7504507-7504507
CAintronicDe novo--Wu2018 G
SORCS2     2-0135-004chr4:
7375973-7375973
AGintronicDe novo--Yuen2017 G
SORCS2     iHART1490chr4:
7666200-7666200
TGsplicingPaternalsplicing15.09-Ruzzo2019 G
SORCS2     AU031404chr4:
7649606-7649606
CTintronicDe novo--Yuen2017 G
SORCS2     AU2495302chr4:
7270386-7270386
CTintronicDe novo--Yuen2017 G
SORCS2     AU024104chr4:
7469667-7469667
TGintronicDe novo--Yuen2017 G
SORCS2     2-1281-003chr4:
7384517-7384517
GAintronicDe novo--Yuen2017 G
SORCS2     DEASD_0104_001chr4:
7716910-7716910
CTexonicDe novosynonymous SNVNM_020777c.C2124Tp.C708C-0.1108DeRubeis2014 E
Kosmicki2017 E
SORCS2     7-0242-003chr4:
7377621-7377621
CTintronicDe novo--Yuen2017 G
SORCS2     AU4122301chr4:
7709867-7709867
ATintronicDe novo--Yuen2017 G
SORCS2     1-0222-003chr4:
7652829-7652829
CGintronicDe novo--Yuen2017 G
SORCS2     AU4228301chr4:
7579338-7579340
GAAGintronicDe novo--Yuen2017 G
SORCS2     2-1526-004chr4:
7238040-7238048
TATCTGAGGTintronicDe novo--Yuen2017 G
SORCS2     11194.p1chr4:
7663980-7663980
ACintronicDe novo--Turner2016 G
SORCS2     AU4235303chr4:
7287985-7287985
TCintronicDe novo--Yuen2017 G
SORCS2     AU2433302chr4:
7358975-7358975
CAintronicDe novo--Yuen2017 G
SORCS2     2-1280-003chr4:
7710986-7710986
GAintronicDe novo--Yuen2017 G
SORCS2     A25chr4:
7252057-7252057
AGintronicDe novo--Wu2018 G
SORCS2     2-0063-003chr4:
7682151-7682151
AGintronicDe novo--Yuen2017 G
SORCS2     1-0565-004chr4:
7530626-7530626
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More