or
or
Exact

Results for "PTCH1"

Variant Events: 36

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PTCH1     A14chr9:
98249110-98249110
AGintronicDe novo--Wu2018 G
PTCH1     2-1120-003chr9:
98334546-98334546
TTGGintergenicDe novo--Yuen2017 G
PTCH1     iHART2661chr9:
98244261-98244261
GAexonicDe novononsynonymous SNVNM_000264
NM_001083602
NM_001083603
NM_001083604
NM_001083605
NM_001083606
NM_001083607
c.C716T
c.C518T
c.C713T
c.C263T
c.C263T
c.C263T
c.C263T
p.A239V
p.A173V
p.A238V
p.A88V
p.A88V
p.A88V
p.A88V
24.7-Ruzzo2019 G
PTCH1     2-1341-004chr9:
98531140-98531140
GGGGTintergenicDe novo--Yuen2017 G
PTCH1     AU003403chr9:
98265289-98265289
CTintronicDe novo--Yuen2017 G
PTCH1     PN400383chr9:
98209490-98209490
GAexonicUnknownnonsynonymous SNVNM_000264
NM_001083602
NM_001083603
NM_001083604
NM_001083605
NM_001083606
NM_001083607
c.C4048T
c.C3850T
c.C4045T
c.C3595T
c.C3595T
c.C3595T
c.C3595T
p.R1350W
p.R1284W
p.R1349W
p.R1199W
p.R1199W
p.R1199W
p.R1199W
17.630.001Leblond2019 E
PTCH1     PN400326chr9:
98209490-98209490
GAexonicUnknownnonsynonymous SNVNM_000264
NM_001083602
NM_001083603
NM_001083604
NM_001083605
NM_001083606
NM_001083607
c.C4048T
c.C3850T
c.C4045T
c.C3595T
c.C3595T
c.C3595T
c.C3595T
p.R1350W
p.R1284W
p.R1349W
p.R1199W
p.R1199W
p.R1199W
p.R1199W
17.630.001Leblond2019 E
PTCH1     1-0126-003chr9:
98287744-98287744
GAintergenicDe novo--Yuen2017 G
PTCH1     AU034903chr9:
98480539-98480539
GAintergenicDe novo--Yuen2017 G
PTCH1     1-0570-003chr9:
98564899-98564901
TGGTGintergenicDe novo--Yuen2017 G
PTCH1     PN400396chr9:
98209490-98209490
GAexonicUnknownnonsynonymous SNVNM_000264
NM_001083602
NM_001083603
NM_001083604
NM_001083605
NM_001083606
NM_001083607
c.C4048T
c.C3850T
c.C4045T
c.C3595T
c.C3595T
c.C3595T
c.C3595T
p.R1350W
p.R1284W
p.R1349W
p.R1199W
p.R1199W
p.R1199W
p.R1199W
17.630.001Leblond2019 E
PTCH1     AU056803chr9:
98251346-98251346
GAintronicDe novo--Yuen2017 G
PTCH1     1-0201-004chr9:
98312414-98312414
GAintergenicDe novo--Yuen2017 G
PTCH1     3-0446-000chr9:
98221922-98221922
GAexonicDe novosynonymous SNVNM_000264
NM_001083602
NM_001083603
NM_001083604
NM_001083605
NM_001083606
NM_001083607
c.C2847T
c.C2649T
c.C2844T
c.C2394T
c.C2394T
c.C2394T
c.C2394T
p.V949V
p.V883V
p.V948V
p.V798V
p.V798V
p.V798V
p.V798V
--Yuen2016 G
Yuen2017 G
PTCH1     AU4336301chr9:
98412349-98412349
CTintergenicDe novo--Yuen2017 G
PTCH1     1-0354-003chr9:
98334546-98334546
TTGGintergenicDe novo--Yuen2017 G
PTCH1     AU3874301chr9:
98469856-98469856
TCintergenicDe novo--Yuen2017 G
PTCH1     2-1644-003chr9:
98334541-98334541
TAintergenicDe novo--Yuen2017 G
PTCH1     AU2458303chr9:
98346659-98346659
GAintergenicDe novo--Yuen2017 G
PTCH1     2-1709-003chr9:
98566706-98566706
ACintergenicDe novo--Yuen2017 G
PTCH1     Li2017:15087chr9:
98211442-98211442
AGexonicUnknownnonsynonymous SNVNM_000264
NM_001083602
NM_001083603
NM_001083604
NM_001083605
NM_001083606
NM_001083607
c.T3713C
c.T3515C
c.T3710C
c.T3260C
c.T3260C
c.T3260C
c.T3260C
p.L1238P
p.L1172P
p.L1237P
p.L1087P
p.L1087P
p.L1087P
p.L1087P
17.76-Li2017 T
PTCH1     1-0406-003chr9:
98543184-98543184
TCintergenicDe novo--Yuen2017 G
PTCH1     PN400486chr9:
98209582-98209582
CTexonicUnknownnonsynonymous SNVNM_000264
NM_001083602
NM_001083603
NM_001083604
NM_001083605
NM_001083606
NM_001083607
c.G3956A
c.G3758A
c.G3953A
c.G3503A
c.G3503A
c.G3503A
c.G3503A
p.R1319H
p.R1253H
p.R1318H
p.R1168H
p.R1168H
p.R1168H
p.R1168H
29.31.732E-5Leblond2019 E
PTCH1     1-0401-003chr9:
98511203-98511203
AGintergenicDe novo--Yuen2017 G
PTCH1     1-0901-003chr9:
98315118-98315118
TTAGintergenicDe novo--Yuen2017 G
PTCH1     SSC09614chr9:
98229669-98229669
GAexonicDe novosynonymous SNVNM_000264
NM_001083602
NM_001083603
NM_001083604
NM_001083605
NM_001083606
NM_001083607
c.C2289T
c.C2091T
c.C2286T
c.C1836T
c.C1836T
c.C1836T
c.C1836T
p.V763V
p.V697V
p.V762V
p.V612V
p.V612V
p.V612V
p.V612V
--Lim2017 E
PTCH1     5-0030-003chr9:
98541027-98541031
TGAAGTintergenicDe novo--Yuen2017 G
PTCH1     1-0551-004chr9:
98524104-98524104
CTintergenicDe novo--Yuen2017 G
PTCH1     2-0214-003chr9:
98319717-98319717
CCAACACAACCACACAACATCACACAGCGAintergenicDe novo--Yuen2017 G
PTCH1     13991.p1chr9:
98229669-98229669
GAexonicDe novosynonymous SNVNM_000264
NM_001083602
NM_001083603
NM_001083604
NM_001083605
NM_001083606
NM_001083607
c.C2289T
c.C2091T
c.C2286T
c.C1836T
c.C1836T
c.C1836T
c.C1836T
p.V763V
p.V697V
p.V762V
p.V612V
p.V612V
p.V612V
p.V612V
--Iossifov2014 E
Kosmicki2017 E
PTCH1     JASD_Fam0130chr9:
98239927-98239927
CTexonicDe novononsynonymous SNVNM_000264
NM_001083602
NM_001083603
NM_001083604
NM_001083605
NM_001083606
NM_001083607
c.G1405A
c.G1207A
c.G1402A
c.G952A
c.G952A
c.G952A
c.G952A
p.V469M
p.V403M
p.V468M
p.V318M
p.V318M
p.V318M
p.V318M
32.0-Takata2018 E
PTCH1     1-0551-003chr9:
98323631-98323631
AGintergenicDe novo--Yuen2017 G
PTCH1     2-0144-003chr9:
98475669-98475669
CTintergenicDe novo--Yuen2017 G
PTCH1     2-1116-003chr9:
98380949-98380949
CTintergenicDe novo--Yuen2017 G
PTCH1     7-0242-003chr9:
98482651-98482651
CTintergenicDe novo--Yuen2017 G
PTCH1     ASC_CA_99_Achr9:
98212075-98212075
CTintronicDe novo--Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More