or
or
Exact

Results for "DIRAS2"

Variant Events: 13

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DIRAS2     2-0012-003chr9:
93420266-93420266
TCintergenicDe novo--Yuen2017 G
DIRAS2     A15chr9:
93403359-93403359
GAintronicDe novo--Wu2018 G
DIRAS2     AU031004chr9:
93553505-93553505
CTintergenicDe novo--Yuen2017 G
DIRAS2     AU4234303chr9:
93394133-93394133
CAintronicDe novo--Yuen2017 G
DIRAS2     AU2433302chr9:
93562401-93562401
GCintergenicDe novo--Yuen2017 G
DIRAS2     2-0149-005chr9:
93500812-93500812
CTintergenicDe novo--Yuen2017 G
DIRAS2     1-0701-003chr9:
93372211-93372211
CTUTR3De novo--Yuen2017 G
DIRAS2     2-1176-003chr9:
93554576-93554576
AGintergenicDe novo--Yuen2017 G
DIRAS2     1-0006-004chr9:
93418726-93418726
TAintergenicDe novo--Yuen2017 G
DIRAS2     1-0225-003chr9:
93512310-93512310
GAintergenicDe novo--Yuen2017 G
DIRAS2     1-0232-004chr9:
93373993-93373993
GAUTR3De novo--Yuen2017 G
DIRAS2     1-0495-003chr9:
93525673-93525673
CTintergenicDe novo--Yuen2017 G
DIRAS2     2-1369-003chr9:
93455381-93455394
CGTGTGTGTGTGTGCGTGTGTGTGTGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More