or
or
Exact

Results for "CNGB3"

Variant Events: 31

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CNGB3     AU039305chr8:
87636929-87636929
GAintronicDe novo--Yuen2017 G
CNGB3     DEASD_0057_001chr8:
87680403-87680403
AAGintronicDe novo-9.311E-5Kosmicki2017 E
CNGB3     AU3637301chr8:
87753952-87753952
AGintronicDe novo--Yuen2017 G
CNGB3     PN400514chr8:
87645092-87645092
CTexonicUnknownnonsynonymous SNVNM_019098c.G1208Ap.R403Q22.50.0051Leblond2019 E
CNGB3     7-0255-003chr8:
87762884-87762884
GAintergenicDe novo--Yuen2017 G
CNGB3     2-1501-003chr8:
87844650-87844650
AGintergenicDe novo--Yuen2017 G
CNGB3     AU3632301chr8:
87847413-87847413
TGintergenicDe novo--Yuen2017 G
CNGB3     DEASD_0290_001chr8:
87588114-87588114
GTexonicDe novostopgainNM_019098c.C2348Ap.S783X38.0-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
CNGB3     7-0123-003chr8:
87738866-87738866
AGexonicDe novosynonymous SNVNM_019098c.T231Cp.N77N--Yuen2017 G
CNGB3     1-0874-003chr8:
87670683-87670683
CAintronicDe novo--Yuen2017 G
CNGB3     13639.p1chr8:
87679119-87679119
GAintronicDe novo-7.0E-4Satterstrom2020 E
CNGB3     7-0251-003chr8:
87623887-87623887
GTexonicDe novononsynonymous SNVNM_019098c.C1591Ap.Q531K27.6-Yuen2017 G
CNGB3     AU3997301chr8:
87795382-87795382
AGintergenicDe novo--Yuen2017 G
CNGB3     AU3905302chr8:
87845542-87845542
CTintergenicDe novo--Yuen2017 G
CNGB3     A17chr8:
87736122-87736122
CAintronicDe novo--Wu2018 G
CNGB3     1-0826-003chr8:
87672709-87672709
GAintronicDe novo--Yuen2017 G
CNGB3     AU4072303chr8:
87818922-87818922
CAintergenicDe novo--Yuen2017 G
CNGB3     AU3862305chr8:
87824347-87824347
GAintergenicDe novo--Yuen2017 G
CNGB3     1-0715-003chr8:
87610142-87610142
GTintronicDe novo--Yuen2017 G
CNGB3     AU4485302chr8:
87840361-87840361
CTintergenicDe novo--Yuen2017 G
CNGB3     PN400179chr8:
87645092-87645092
CTexonicUnknownnonsynonymous SNVNM_019098c.G1208Ap.R403Q22.50.0051Leblond2019 E
CNGB3     iHART2259chr8:
87666245-87666250
ATTTTGAexonicPaternalframeshift deletionNM_019098c.893_897delp.T298fs-6.603E-5Ruzzo2019 G
CNGB3     2-1605-004chr8:
87858769-87858777
TAATATCAATintergenicDe novo--Yuen2017 G
CNGB3     iHART1327chr8:
87590934-87590934
GAexonicPaternalstopgainNM_019098c.C2086Tp.R696X28.14.0E-4Ruzzo2019 G
CNGB3     1-0450-003chr8:
87843034-87843034
GCintergenicDe novo--Yuen2017 G
CNGB3     PN400186chr8:
87645092-87645092
CTexonicUnknownnonsynonymous SNVNM_019098c.G1208Ap.R403Q22.50.0051Leblond2019 E
CNGB3     AU2075301chr8:
87818554-87818586
AACCAAAACAGCATGCTACTGGTACCAAAACAGAACCAAAACAGCATGCTACTGGTACCAAAACAGCATGCTACTGGTACCAAAACAGintergenicDe novo--Yuen2017 G
CNGB3     12056.p1chr8:
87673711-87673711
CTintronicMosaic--Dou2017 E
CNGB3     2-1128-003chr8:
87853384-87853384
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
CNGB3     1-0233-004chr8:
87697075-87697075
AGintronicDe novo--Yuen2017 G
CNGB3     SSC08756chr8:
87588291-87588291
TAexonicMosaicnonsynonymous SNVNM_019098c.A2171Tp.E724V2.232-Lim2017 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More