or
or
Exact

Results for "CDK14"

Variant Events: 39

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CDK14     2-1486-003chr7:
90512276-90512276
AGintronicDe novo--Yuen2016 G
Yuen2017 G
CDK14     AU2292301chr7:
90446901-90446920
TTTTGTTTGTTTGTTTGTTTTTTTGTTTGTTTGTTTintronicDe novo--Yuen2017 G
CDK14     AU2292302chr7:
90446901-90446920
TTTTGTTTGTTTGTTTGTTTTTTTGTTTGTTTGTTTintronicDe novo--Yuen2017 G
CDK14     2-1382-003chr7:
90722566-90722566
ACintronicDe novo--Yuen2016 G
Yuen2017 G
CDK14     1-0570-003chr7:
90834353-90834364
TAAACAAACAAATAAACAAAintronicDe novo--Yuen2017 G
CDK14     1-0978-003chr7:
90734734-90734734
ATintronicDe novo--Yuen2017 G
CDK14     AU4306302chr7:
90666741-90666741
CTintronicDe novo--Yuen2017 G
CDK14     1-0494-003chr7:
90231224-90231224
GAintronicDe novo--Yuen2017 G
CDK14     1-0835-003chr7:
90547013-90547013
CTexonicDe novononsynonymous SNVNM_001287137
NM_001287136
NM_012395
NM_001287135
c.C413T
c.C662T
c.C746T
c.C800T
p.T138M
p.T221M
p.T249M
p.T267M
16.978.24E-6Yuen2017 G
CDK14     5-0046-003chr7:
90873652-90873652
GAintergenicDe novo--Yuen2017 G
CDK14     5-0146-003chr7:
90719520-90719520
TCintronicDe novo--Yuen2017 G
CDK14     2-1577-003chr7:
90804950-90804950
CTintronicDe novo--Yuen2017 G
CDK14     A13chr7:
90446282-90446282
GAintronicDe novo--Wu2018 G
CDK14     2-1454-003chr7:
90393703-90393703
ACintronicDe novo--Yuen2017 G
CDK14     AU3713302chr7:
90326626-90326630
GAAAAGAAAintronicDe novo--Yuen2017 G
CDK14     1-0625-003chr7:
90369158-90369158
GAintronicDe novo--Yuen2017 G
CDK14     7-0055-003chr7:
90343218-90343218
CAintronicDe novo--Yuen2017 G
CDK14     AU011021chr7:
90533231-90533231
GAintronicDe novo--Yuen2017 G
CDK14     AU3900302chr7:
90568125-90568125
ATintronicDe novo--Yuen2017 G
CDK14     AU4027306chr7:
90538150-90538150
ACintronicDe novo--Yuen2017 G
CDK14     1-0555-003chr7:
90376590-90376590
CTintronicDe novo--Yuen2017 G
CDK14     AU2427301chr7:
90314152-90314152
AGintronicDe novo--Yuen2017 G
CDK14     1-0246-004chr7:
90402396-90402396
GAintronicDe novo--Yuen2017 G
CDK14     2-0012-004chr7:
90573783-90573783
CTintronicDe novo--Yuen2017 G
CDK14     AU4103301chr7:
90497103-90497103
GTintronicDe novo--Yuen2017 G
CDK14     AU1725306chr7:
90669741-90669741
CAintronicDe novo--Yuen2017 G
CDK14     AU4231301chr7:
90284043-90284043
CTintronicDe novo--Yuen2017 G
CDK14     2-1421-003chr7:
90423865-90423865
CAintronicDe novo--Yuen2017 G
CDK14     AU3912301chr7:
90490580-90490580
ATintronicDe novo--Yuen2017 G
CDK14     5-0077-003chr7:
90353910-90353910
AGintronicDe novo--Yuen2017 G
CDK14     3-0431-000chr7:
90355990-90355990
GAexonicDe novononsynonymous SNVNM_001287136
NM_012395
NM_001287135
c.G95A
c.G179A
c.G233A
p.S32N
p.S60N
p.S78N
17.12-Yuen2016 G
Yuen2017 G
CDK14     7-0148-003chr7:
90888232-90888232
AGintergenicDe novo--Yuen2017 G
CDK14     DEASD_1098_001chr7:
90356106-90356106
CGexonicDe novononsynonymous SNVNM_001287136
NM_012395
NM_001287135
c.C211G
c.C295G
c.C349G
p.R71G
p.R99G
p.R117G
14.78-Satterstrom2020 E
CDK14     2-1245-003chr7:
90710892-90710892
TCintronicDe novo--Yuen2017 G
CDK14     2-1391-003chr7:
90460407-90460407
AGintronicDe novo--Yuen2017 G
CDK14     3-0431-000chr7:
90516152-90516152
GAintronicDe novo--Yuen2016 G
Yuen2017 G
CDK14     14482.p1chr7:
90460836-90460836
TCintronicDe novo--Turner2016 G
CDK14     1-0494-003Achr7:
90231224-90231224
GAintronicDe novo--Yuen2017 G
CDK14     AU3847302chr7:
90667374-90667374
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More