or
or
Exact

Results for "PDHA2"

Variant Events: 87

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PDHA2     AU056005chr4:
97428572-97428572
CTintergenicDe novo--Yuen2017 G
PDHA2     2-1411-003chr4:
98182577-98182580
CTGTCTintergenicDe novo--Yuen2017 G
PDHA2     2-1269-003chr4:
97953124-97953124
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
PDHA2     7-0143-003chr4:
97969635-97969635
CAintergenicDe novo--Yuen2017 G
PDHA2     AU4188302chr4:
97314768-97314768
GCintergenicDe novo--Yuen2017 G
PDHA2     1-0914-003chr4:
97729569-97729569
GAintergenicDe novo--Yuen2017 G
PDHA2     AU047704chr4:
97571748-97571748
CAintergenicDe novo--Yuen2017 G
PDHA2     1-0551-004chr4:
98146457-98146457
GTintergenicDe novo--Yuen2017 G
PDHA2     1-0289-004chr4:
97142263-97142263
TCintergenicDe novo--Yuen2017 G
PDHA2     AU3702306chr4:
97500700-97500700
AGintergenicDe novo--Yuen2017 G
PDHA2     2-1228-003chr4:
97059950-97059950
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
PDHA2     AU3702306chr4:
97936311-97936311
ACintergenicDe novo--Yuen2017 G
PDHA2     7-0078-003chr4:
97913996-97913996
ACintergenicDe novo--Yuen2017 G
PDHA2     AU2019302chr4:
97691377-97691377
AGintergenicDe novo--Yuen2017 G
PDHA2     AU3875301chr4:
97635378-97635378
AGintergenicDe novo--Yuen2017 G
PDHA2     2-1365-003chr4:
97298252-97298254
CTGCintergenicDe novo--Yuen2016 G
PDHA2     2-0306-004chr4:
98224302-98224302
TAintergenicDe novo--Yuen2017 G
PDHA2     AU4473301chr4:
98213228-98213228
CTintergenicDe novo--Yuen2017 G
PDHA2     1-0263-003chr4:
97482773-97482773
TGintergenicDe novo--Yuen2016 G
PDHA2     13946.p1chr4:
97064060-97064060
TCintergenicDe novo--Turner2016 G
PDHA2     12680.p1chr4:
97613851-97613851
ACintergenicDe novo--Turner2016 G
PDHA2     5-0014-003chr4:
97261587-97261587
CAintergenicDe novo--Yuen2017 G
PDHA2     2-1366-003chr4:
97910950-97910950
TCintergenicDe novo--Yuen2017 G
PDHA2     AU2863303chr4:
97001585-97001585
AGintergenicDe novo--Yuen2017 G
PDHA2     2-0182-003chr4:
97977123-97977123
GAintergenicDe novo--Yuen2017 G
PDHA2     2-1417-003chr4:
96845401-96845401
AGintergenicDe novo--Yuen2017 G
PDHA2     1-0304-003chr4:
97140391-97140406
ATGTGTGTGTGTGTGTATGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
PDHA2     2-1288-003chr4:
98236464-98236464
CTintergenicDe novo--Yuen2017 G
PDHA2     AU3912301chr4:
97402386-97402386
TCintergenicDe novo--Yuen2017 G
PDHA2     3-0140-000chr4:
97549350-97549350
AGintergenicDe novo--Yuen2017 G
PDHA2     1-0248-003chr4:
97517526-97517526
AGintergenicDe novo--Yuen2017 G
PDHA2     2-1089-003chr4:
97446489-97446489
TCintergenicDe novo--Yuen2017 G
PDHA2     2-0306-003chr4:
98224302-98224302
TAintergenicDe novo--Yuen2016 G
PDHA2     1-0233-004chr4:
97231653-97231653
TTTCGTCGintergenicDe novo--Yuen2017 G
PDHA2     1-0323-003chr4:
97861614-97861614
GCintergenicDe novo--Yuen2017 G
PDHA2     A7chr4:
98281373-98281373
TCintergenicDe novo--Wu2018 G
PDHA2     2-1378-003chr4:
98170262-98170262
GAintergenicDe novo--Yuen2017 G
PDHA2     2-1549-003chr4:
97222670-97222670
TCintergenicDe novo--Yuen2017 G
PDHA2     5-0088-003chr4:
98283040-98283040
GTintergenicDe novo--Yuen2017 G
PDHA2     AU3911302chr4:
97484861-97484861
AGintergenicDe novo--Yuen2017 G
PDHA2     AU2089302chr4:
97582317-97582317
TCintergenicDe novo--Yuen2017 G
PDHA2     3-0080-000chr4:
97401500-97401500
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
PDHA2     AU4468301chr4:
97762783-97762783
TCintergenicDe novo--Yuen2017 G
PDHA2     3-0391-000chr4:
97894102-97894102
CAintergenicDe novo--Yuen2017 G
PDHA2     2-1629-003chr4:
98252857-98252857
AGintergenicDe novo--Yuen2017 G
PDHA2     2-0310-003chr4:
98210610-98210610
CTintergenicDe novo--Yuen2017 G
PDHA2     7-0251-003chr4:
97655565-97655580
TTCTCTCTCTCTCTCTTTCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
PDHA2     1-0186-004chr4:
98228455-98228455
CTintergenicDe novo--Yuen2017 G
PDHA2     2-1359-004chr4:
98218568-98218568
TGintergenicDe novo--Yuen2017 G
PDHA2     AU3371305chr4:
97430577-97430577
CGintergenicDe novo--Yuen2017 G
PDHA2     AU1742302chr4:
96899610-96899610
GCintergenicDe novo--Yuen2017 G
PDHA2     1-0868-003chr4:
97433635-97433635
CTintergenicDe novo--Yuen2017 G
PDHA2     AU072505chr4:
97148696-97148696
AGintergenicDe novo--Yuen2017 G
PDHA2     2-1222-003chr4:
97742538-97742538
CTintergenicDe novo--Yuen2017 G
PDHA2     AU1725306chr4:
97403490-97403490
GAintergenicDe novo--Yuen2017 G
PDHA2     A15chr4:
98256049-98256049
AGintergenicDe novo--Wu2018 G
PDHA2     AU0780302chr4:
97651241-97651241
CTintergenicDe novo--Yuen2017 G
PDHA2     1-0225-003chr4:
98128182-98128182
GAintergenicDe novo--Yuen2017 G
PDHA2     1-0699-003chr4:
97690190-97690190
GAintergenicDe novo--Yuen2017 G
PDHA2     1-0699-003chr4:
97065080-97065080
ACintergenicDe novo--Yuen2017 G
PDHA2     AU030103chr4:
96954843-96954843
GAintergenicDe novo--Yuen2017 G
PDHA2     1-0473-003chr4:
97231653-97231653
TTTCGTCGintergenicDe novo--Yuen2017 G
PDHA2     1-0344-003chr4:
97894350-97894350
TCintergenicDe novo--Yuen2017 G
PDHA2     2-0210-004chr4:
97908103-97908103
AGintergenicDe novo--Yuen2017 G
PDHA2     2-1605-004chr4:
98080414-98080414
AGintergenicDe novo--Yuen2017 G
PDHA2     AU3900301chr4:
96942453-96942453
CGintergenicDe novo--Yuen2017 G
PDHA2     1-0436-003chr4:
98228778-98228778
TCintergenicDe novo--Yuen2017 G
PDHA2     iHART1713chr4:
96761533-96761533
CTexonicMaternalstopgainNM_005390c.C232Tp.Q78X36.02.0E-4Ruzzo2019 G
PDHA2     iHART1710chr4:
96761533-96761533
CTexonicMaternalstopgainNM_005390c.C232Tp.Q78X36.02.0E-4Ruzzo2019 G
PDHA2     2-1169-003chr4:
97830427-97830427
AATintergenicDe novo--Yuen2017 G
PDHA2     3-0065-000chr4:
97895377-97895386
TAAGAAGAAGTAAGAAGintergenicDe novo--Yuen2017 G
PDHA2     AU4054301chr4:
96853531-96853531
GAintergenicDe novo--Yuen2017 G
PDHA2     AU3865301chr4:
97357125-97357125
CTintergenicDe novo--Yuen2017 G
PDHA2     3-0442-000chr4:
98084223-98084223
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
PDHA2     1-1000-003chr4:
97247816-97247835
ATCTCTCTCTCTCTCTCTCTATCTCTCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
PDHA2     1-0998-003chr4:
98172492-98172492
ACintergenicDe novo--Yuen2017 G
PDHA2     2-1222-003chr4:
96793916-96793916
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
PDHA2     1-0019-004chr4:
97527844-97527844
AGintergenicDe novo--Yuen2017 G
PDHA2     AU4211304chr4:
97120465-97120465
CTintergenicDe novo--Yuen2017 G
PDHA2     AU4306302chr4:
98028193-98028193
ACintergenicDe novo--Yuen2017 G
PDHA2     7-0008-003chr4:
97277740-97277740
TCintergenicDe novo--Yuen2017 G
PDHA2     1-0629-003chr4:
97056044-97056044
AGintergenicDe novo--Yuen2017 G
PDHA2     2-1275-003chr4:
97883665-97883665
ACintergenicDe novo--Yuen2017 G
PDHA2     7-0123-003chr4:
97370180-97370180
CGintergenicDe novo--Yuen2017 G
PDHA2     AU4234302 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
PDHA2     2-1251-003chr4:
98280121-98280121
GAintergenicDe novo--Yuen2017 G
PDHA2     2-1272-003chr4:
98129897-98129898
ATAintergenicDe novo--Yuen2016 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More