or
or
Exact

Results for "OPRK1"

Variant Events: 51

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
OPRK1     2-1174-005Bchr8:
54506573-54506573
CCACAATAintergenicDe novo--Yuen2017 G
OPRK1     1-0126-003chr8:
54506545-54506545
AACACATintergenicDe novo--Yuen2017 G
OPRK1     NDAR_INVWJ774DL8_wes1chr8:
54142225-54142225
GTexonicDe novononsynonymous SNVNM_000912
NM_001282904
c.C775A
c.C508A
p.L259I
p.L170I
14.09-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
OPRK1     AU046706chr8:
54385153-54385153
CAintergenicDe novo--Yuen2017 G
OPRK1     1-0541-003chr8:
54391693-54391693
CAintergenicDe novo--Yuen2017 G
OPRK1     2-1148-004chr8:
54506564-54506564
TTACACACAATACACACACintergenicDe novo--Yuen2017 G
OPRK1     2-1635-004chr8:
54506583-54506583
AACCACATACACCATATintergenicDe novo--Yuen2017 G
OPRK1     AU2292302chr8:
54485359-54485359
CTintergenicDe novo--Yuen2017 G
OPRK1     1-0300-004chr8:
54506589-54506589
TTATACintergenicDe novo--Yuen2017 G
OPRK1     1-0373-003chr8:
54506578-54506578
CCACCCCATATATATintergenicDe novo--Yuen2017 G
OPRK1     5-0133-003chr8:
54613322-54613322
TGintergenicDe novo--Yuen2017 G
OPRK1     1-0406-003chr8:
54506577-54506577
AACintergenicDe novo--Yuen2017 G
OPRK1     2-1322-004chr8:
54528725-54528725
AACintergenicDe novo--Yuen2017 G
OPRK1     AU4487302chr8:
54624730-54624733
ATTTATTintergenicDe novo--Yuen2017 G
OPRK1     1-0162-004chr8:
54506696-54506696
CCACATintergenicDe novo--Yuen2017 G
OPRK1     AU3052301chr8:
54589275-54589279
TTTTGTintergenicDe novo--Yuen2017 G
OPRK1     1-0638-003chr8:
54532053-54532053
AGintergenicDe novo--Yuen2017 G
OPRK1     5-0117-003chr8:
54278171-54278171
TGintergenicDe novo--Yuen2017 G
OPRK1     7-0095-003chr8:
54506560-54506560
CCGTATATintergenicDe novo--Yuen2017 G
OPRK1     1-0138-003chr8:
54506571-54506571
CCACACAACACAAGACATATCATintergenicDe novo--Yuen2017 G
OPRK1     2-1398-003chr8:
54506571-54506571
CCACAACACAAGACATATCATintergenicDe novo--Yuen2017 G
OPRK1     1-0347-003chr8:
54506576-54506576
CCATAGACATCGTATATintergenicDe novo--Yuen2017 G
OPRK1     7-0059-003chr8:
54412376-54412376
GAintergenicDe novo--Yuen2017 G
OPRK1     A17chr8:
54569914-54569914
GTintergenicDe novo--Wu2018 G
OPRK1     1-0332-003chr8:
54506571-54506571
CCACACAACACAAGACATATCATintergenicDe novo--Yuen2017 G
OPRK1     5-0003-003chr8:
54506545-54506545
AACACATintergenicDe novo--Yuen2017 G
OPRK1     AU2292301chr8:
54485359-54485359
CTintergenicDe novo--Yuen2017 G
OPRK1     1-0565-004chr8:
54506564-54506564
TTATAintergenicDe novo--Yuen2017 G
OPRK1     AU3517301chr8:
54489710-54489710
TGintergenicDe novo--Yuen2017 G
OPRK1     2-0307-004chr8:
54289358-54289358
CGintergenicDe novo--Yuen2017 G
OPRK1     PN400253chr8:
54142213-54142213
GAexonicInheritedstopgainNM_000912
NM_001282904
c.C787T
c.C520T
p.R263X
p.R174X
19.433.0E-4Leblond2019 E
OPRK1     1-0010-003chr8:
54506567-54506567
CCCATATintergenicDe novo--Yuen2017 G
OPRK1     AU2089302chr8:
54337667-54337667
GAintergenicDe novo--Yuen2017 G
OPRK1     2-1632-003chr8:
54371999-54371999
TCintergenicDe novo--Yuen2017 G
OPRK1     1-0112-003chr8:
54506576-54506576
CCATAGACATCGTATATintergenicDe novo--Yuen2017 G
OPRK1     2-1342-003chr8:
54615223-54615223
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
OPRK1     2-0109-003chr8:
54506560-54506560
CCGTATATintergenicDe novo--Yuen2017 G
OPRK1     1-0206-004chr8:
54506576-54506576
CCACACCCCATATATintergenicDe novo--Yuen2017 G
OPRK1     1-0455-003chr8:
54506616-54506616
ACintergenicDe novo--Yuen2017 G
OPRK1     1-0191-004chr8:
54506578-54506578
CCACAGCATATATATintergenicDe novo--Yuen2017 G
OPRK1     1-0380-003chr8:
54506589-54506589
TTATACintergenicDe novo--Yuen2017 G
OPRK1     1-0201-005chr8:
54506573-54506573
CCAATAintergenicDe novo--Yuen2017 G
OPRK1     AU057503chr8:
54525361-54525361
CGintergenicDe novo--Yuen2017 G
OPRK1     AU057503chr8:
54535439-54535439
ACintergenicDe novo--Yuen2017 G
OPRK1     1-0565-003chr8:
54506551-54506551
AACACCACATintergenicDe novo--Yuen2017 G
OPRK1     1-0595-004chr8:
54506564-54506564
TTACACACCGTATATACACACAATACACACACintergenicDe novo--Yuen2017 G
OPRK1     2-0214-003chr8:
54506551-54506551
AACACCACATintergenicDe novo--Yuen2017 G
OPRK1     2-0135-004chr8:
54506545-54506545
AACACATintergenicDe novo--Yuen2017 G
OPRK1     1-1004-003chr8:
54364929-54364929
CTintergenicDe novo--Yuen2017 G
OPRK1     2-1508-003chr8:
54506576-54506576
CCATAGACATCGTATATintergenicDe novo--Yuen2017 G
OPRK1     AU2140305chr8:
54285396-54285397
ACAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More