or
or
Exact

Results for "ROR1"

Variant Events: 17

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ROR1     1-0674-003chr1:
64248363-64248363
GAintronicDe novo--Yuen2017 G
ROR1     7-0127-003chr1:
64635141-64635141
CTintronicDe novo--Yuen2017 G
ROR1     AU3787303chr1:
64495191-64495191
TGintronicDe novo--Yuen2017 G
ROR1     12113.p1chr1:
64384525-64384525
GTintronicDe novo--Wilfert2021 G
ROR1     AU3051303chr1:
64337881-64337881
CTintronicDe novo--Yuen2017 G
ROR1     1-0751-003chr1:
64593189-64593204
GTCTCTCTCTCTCTCTGTCTCTCTCTCTCTintronicDe novo--Yuen2017 G
ROR1     2-1422-003chr1:
64357464-64357464
TCintronicDe novo--Yuen2016 G
Yuen2017 G
ROR1     AU4286302chr1:
64468141-64468141
ATintronicDe novo--Yuen2017 G
ROR1     1-0627-005chr1:
64383380-64383380
GAintronicDe novo--Yuen2017 G
ROR1     1-0045-004chr1:
64547109-64547109
ACintronicDe novo--Yuen2017 G
ROR1     5-0077-004chr1:
64614747-64614747
ATintronicDe novo--Yuen2017 G
ROR1     1-0402-003chr1:
64543834-64543839
ATTATCAintronicDe novo--Yuen2017 G
ROR1     60-2027chr1:
64299854-64299854
CTintronicDe novo--Michaelson2012 G
ROR1     1-0073-003chr1:
64323790-64323790
AGintronicDe novo--Yuen2017 G
ROR1     2-0289-003chr1:
64592874-64592874
CGintronicDe novo--Yuen2017 G
ROR1     A15chr1:
64475470-64475470
GCintronicDe novo--Wu2018 G
ROR1     AU1988302chr1:
64310101-64310101
ATintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More