or
or
Exact

Results for "MSR1"

Variant Events: 57

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MSR1     1-0344-003chr8:
16780398-16780398
GAintergenicDe novo--Yuen2017 G
MSR1     AU1933302chr8:
16045786-16045790
ATTTTATTTTTintronicDe novo--Yuen2017 G
MSR1     2-1176-003chr8:
16382403-16382403
CTintergenicDe novo--Yuen2017 G
MSR1     2-1174-005Bchr8:
16519389-16519391
CATCintergenicDe novo--Yuen2017 G
MSR1     2-1391-004chr8:
16411164-16411164
CGintergenicDe novo--Yuen2017 G
MSR1     AU024105chr8:
16462052-16462052
GAintergenicDe novo--Yuen2017 G
MSR1     2-0319-003chr8:
16539862-16539862
TAintergenicDe novo--Yuen2017 G
MSR1     AU3997302chr8:
15978093-15978093
CAexonicDe novosynonymous SNVNM_138715c.G1056Tp.L352L--Yuen2017 G
MSR1     AU4283301chr8:
16689773-16689773
TGintergenicDe novo--Yuen2017 G
MSR1     7-0151-003chr8:
16457722-16457722
AGintergenicDe novo--Yuen2017 G
MSR1     AU4336301chr8:
16355433-16355433
GAintergenicDe novo--Yuen2017 G
MSR1     AU2787301chr8:
16082408-16082408
CTintergenicDe novo--Yuen2017 G
MSR1     1-0533-003chr8:
16503154-16503154
CAintergenicDe novo--Yuen2017 G
MSR1     2-1577-003chr8:
16848078-16848078
TGintergenicDe novo--Yuen2017 G
MSR1     AU027506chr8:
16675637-16675637
CTintergenicDe novo--Yuen2017 G
MSR1     AU4412302chr8:
16393150-16393150
CTintergenicDe novo--Yuen2017 G
MSR1     PN400266chr8:
16012594-16012594
GAexonicUnknownstopgainNM_002445
NM_138715
NM_138716
c.C877T
c.C877T
c.C877T
p.R293X
p.R293X
p.R293X
38.00.0074Leblond2019 E
MSR1     5-0054-003chr8:
16722795-16722795
CTintergenicDe novo--Yuen2017 G
MSR1     2-1207-003chr8:
16778545-16778545
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
MSR1     PN400375chr8:
16012594-16012594
GAexonicUnknownstopgainNM_002445
NM_138715
NM_138716
c.C877T
c.C877T
c.C877T
p.R293X
p.R293X
p.R293X
38.00.0074Leblond2019 E
MSR1     A17chr8:
16146508-16146508
AGintergenicDe novo--Wu2018 G
MSR1     1-0590-003chr8:
16685020-16685020
ACintergenicDe novo--Yuen2017 G
MSR1     AU3964302chr8:
16376827-16376827
TCintergenicDe novo--Yuen2017 G
MSR1     2-1360-003chr8:
16173558-16173558
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
MSR1     2-1360-003chr8:
16213236-16213236
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
MSR1     04C32624chr8:
16032828-16032828
CGintronicDe novo--Satterstrom2020 E
MSR1     1-0138-003chr8:
16822249-16822249
AATGintergenicDe novo--Yuen2017 G
MSR1     2-1278-003chr8:
16083926-16083926
GAintergenicDe novo--Yuen2017 G
MSR1     AU2109302chr8:
16547811-16547811
GTintergenicDe novo--Yuen2017 G
MSR1     5-0105-003chr8:
16297334-16297334
GCintergenicDe novo--Yuen2017 G
MSR1     AU3712301chr8:
16729883-16729883
CAintergenicDe novo--Yuen2017 G
MSR1     AU4243302chr8:
16140814-16140814
CAintergenicDe novo--Yuen2017 G
MSR1     AU4243302chr8:
16141118-16141118
CTintergenicDe novo--Yuen2017 G
MSR1     2-1323-003chr8:
16050021-16050035
GCACACACACACACAGCACACACACACAintronicDe novo--Yuen2017 G
MSR1     2-1376-003chr8:
16236300-16236300
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
MSR1     AU024606chr8:
16820971-16820971
CTintergenicDe novo--Yuen2017 G
MSR1     AU3807302chr8:
16314566-16314566
GAintergenicDe novo--Yuen2017 G
MSR1     5-0046-003chr8:
16437318-16437318
GAintergenicDe novo--Yuen2017 G
MSR1     1-0488-003chr8:
16704168-16704168
CTintergenicDe novo--Yuen2017 G
MSR1     2-0286-003chr8:
16402596-16402596
CGintergenicDe novo--Yuen2017 G
MSR1     PN400330chr8:
16012594-16012594
GAexonicUnknownstopgainNM_002445
NM_138715
NM_138716
c.C877T
c.C877T
c.C877T
p.R293X
p.R293X
p.R293X
38.00.0074Leblond2019 E
MSR1     1-0393-003chr8:
16438761-16438761
CTintergenicDe novo--Yuen2017 G
MSR1     AU074403chr8:
16505707-16505707
CGintergenicDe novo--Yuen2017 G
MSR1     PN400215chr8:
16012594-16012594
GAexonicUnknownstopgainNM_002445
NM_138715
NM_138716
c.C877T
c.C877T
c.C877T
p.R293X
p.R293X
p.R293X
38.00.0074Leblond2019 E
MSR1     1-0541-004chr8:
16657339-16657339
CTintergenicDe novo--Yuen2017 G
MSR1     2-1210-003chr8:
16053433-16053433
CTintergenicDe novo--Yuen2017 G
MSR1     1-0051-005chr8:
16489207-16489207
AGintergenicDe novo--Yuen2017 G
MSR1     1-0985-003chr8:
16839088-16839088
GCintergenicDe novo--Yuen2017 G
MSR1     1-0224-004chr8:
16822249-16822249
AATGintergenicDe novo--Yuen2017 G
MSR1     2-1291-003chr8:
16794807-16794807
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
MSR1     PN400264chr8:
16012594-16012594
GAexonicUnknownstopgainNM_002445
NM_138715
NM_138716
c.C877T
c.C877T
c.C877T
p.R293X
p.R293X
p.R293X
38.00.0074Leblond2019 E
MSR1     1-0051-005chr8:
16762925-16762928
AAACAintergenicDe novo--Yuen2017 G
MSR1     AU2950302chr8:
16565674-16565674
TCintergenicDe novo--Yuen2017 G
MSR1     2-1720-003chr8:
16268537-16268537
ACintergenicDe novo--Yuen2017 G
MSR1     1-0520-003chr8:
16415377-16415377
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
MSR1     2-1291-003chr8:
16799431-16799431
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
MSR1     2-1379-003chr8:
16139510-16139510
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More