or
or
Exact

Results for "AUTS2"

Variant Events: 87

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
AUTS2     AU1988302chr7:
69582401-69582401
TCintronicDe novo--Yuen2017 G
AUTS2     2-0272-003chr7:
69192748-69192748
TCintronicDe novo--Yuen2017 G
AUTS2     2-1093-009chr7:
69805681-69805681
TGintronicDe novo--Yuen2017 G
AUTS2     1-0402-004chr7:
69868873-69868873
GAintronicDe novo--Yuen2017 G
AUTS2     7-0102-003chr7:
70007764-70007764
CAintronicDe novo--Yuen2017 G
AUTS2     12360.p1chr7:
69283187-69283188
TGTintronicDe novo--Wilfert2021 G
AUTS2     1-0153-004chr7:
69079322-69079322
CCTTTTCTTTCTintronicDe novo--Yuen2017 G
AUTS2     1-0300-004chr7:
69780880-69780880
GAintronicDe novo--Yuen2017 G
AUTS2     AU4032305chr7:
69168407-69168407
ATintronicDe novo--Yuen2017 G
AUTS2     1-0465-003achr7:
69834050-69834050
AGintronicDe novo--Yuen2017 G
AUTS2     14642.p1chr7:
69203056-69203056
TCintronicDe novo--Turner2016 G
AUTS2     2-1188-003chr7:
70093809-70093809
CTintronicDe novo--Yuen2017 G
AUTS2     13023.p1chr7:
69345245-69345245
CTintronicDe novo--Turner2016 G
AUTS2     Husson2020:215chr7:
70228095-70228097
ACAAexonicframeshift deletionNM_001127231
NM_015570
c.983_984del
c.983_984del
p.T328fs
p.T328fs
--Husson2020 E
AUTS2     AU2437302chr7:
69404401-69404401
AGintronicDe novo--Yuen2017 G
AUTS2     14153.p1chr7:
69109325-69109325
CTintronicDe novo--Turner2016 G
AUTS2     2-1180-003chr7:
69917554-69917554
AGintronicDe novo--Yuen2016 G
Yuen2017 G
AUTS2     1-0668-003chr7:
70105268-70105268
AGintronicDe novo--Yuen2017 G
AUTS2     11002.p1chr7:
70444871-70444871
CTintergenicDe novo--Turner2016 G
AUTS2     AU075703chr7:
70387043-70387043
GAintergenicDe novo--Yuen2017 G
AUTS2     AU1933301chr7:
69228386-69228386
TCintronicDe novo--Yuen2017 G
AUTS2     1-0052-004chr7:
69241109-69241111
CAGCintronicDe novo--Yuen2017 G
AUTS2     AU4079301chr7:
69295696-69295696
AGintronicDe novo--Yuen2017 G
AUTS2     AU3053301chr7:
70397384-70397384
CTintergenicDe novo--Yuen2017 G
AUTS2     1-0277-003chr7:
70084148-70084148
CTintronicDe novo--Yuen2017 G
AUTS2     AU4215302chr7:
70286729-70286729
CGintergenicDe novo--Yuen2017 G
AUTS2     2-1690-003chr7:
69374188-69374188
CGintronicDe novo--Yuen2017 G
AUTS2     1-0271-004chr7:
69403425-69403425
TGintronicDe novo--Yuen2017 G
AUTS2     2-1407-003chr7:
70255088-70255088
CTexonicDe novosynonymous SNVNM_001127231
NM_015570
c.C2814T
c.C2886T
p.A938A
p.A962A
-2.363E-5Yuen2016 G
AUTS2     AU4072303chr7:
69071694-69071695
TGTintronicDe novo--Yuen2017 G
AUTS2     AU4197301chr7:
70497863-70497863
GAintergenicDe novo--Yuen2017 G
AUTS2     AU1355301chr7:
70005325-70005325
CGintronicDe novo--Yuen2017 G
AUTS2     1-0539-003chr7:
69831012-69831012
CAintronicDe novo--Yuen2017 G
AUTS2     1-0046-003chr7:
69869939-69869939
TAintronicDe novo--Yuen2016 G
Yuen2017 G
AUTS2     1-0144-004chr7:
69337397-69337397
CGintronicDe novo--Yuen2017 G
AUTS2     1-0465-003chr7:
69834050-69834050
AGintronicDe novo--Yuen2017 G
AUTS2     2-1459-003chr7:
69611861-69611861
AGintronicDe novo--Yuen2016 G
Yuen2017 G
AUTS2     1-0745-003chr7:
69249613-69249613
GAintronicDe novo--Yuen2017 G
AUTS2     1-0112-004chr7:
70518335-70518335
TTGAintergenicDe novo--Yuen2017 G
AUTS2     1-0497-003chr7:
69919131-69919131
GAintronicDe novo--Yuen2017 G
AUTS2     2-1127-003chr7:
70280008-70280008
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
AUTS2     2-1506-003chr7:
69340868-69340868
GAintronicDe novo--Yuen2017 G
AUTS2     2-1338-003chr7:
70173062-70173062
AGintronicDe novo--Yuen2017 G
AUTS2     5-0073-003chr7:
69904300-69904300
GAintronicDe novo--Yuen2017 G
AUTS2     5-0095-003chr7:
70543258-70543258
CTintergenicDe novo--Yuen2017 G
AUTS2     08C78430chr7:
70246754-70246754
TGintronicDe novo--Satterstrom2020 E
AUTS2     2-1741-003chr7:
69852879-69852879
ATintronicDe novo--Yuen2017 G
AUTS2     AU2293301chr7:
69369444-69369448
ACTCTACTintronicDe novo--Yuen2017 G
AUTS2     AU4012302chr7:
70340537-70340537
GAintergenicDe novo--Yuen2017 G
AUTS2     2-0063-003chr7:
70376637-70376637
TCintergenicDe novo--Yuen2017 G
AUTS2     AU3761302chr7:
70346293-70346293
GAintergenicDe novo--Yuen2017 G
AUTS2     1-0121-003chr7:
70255089-70255089
GAexonicDe novononsynonymous SNVNM_001127231
NM_015570
c.G2815A
c.G2887A
p.E939K
p.E963K
17.17-Yuen2017 G
AUTS2     AU3779301chr7:
70194463-70194463
AGintronicDe novo--Yuen2017 G
AUTS2     1-0868-003chr7:
70007126-70007126
GTintronicDe novo--Yuen2017 G
AUTS2     1-0756-003chr7:
70438887-70438887
AAAGintergenicDe novo--Yuen2017 G
AUTS2     2-1629-003chr7:
69539474-69539474
TCintronicDe novo--Yuen2017 G
AUTS2     1-0171-005chr7:
70333754-70333754
GAintergenicDe novo--Yuen2017 G
AUTS2     1-0289-003chr7:
69108619-69108619
CAintronicDe novo--Yuen2017 G
AUTS2     2-1269-003chr7:
70135588-70135588
GAintronicDe novo--Yuen2017 G
AUTS2     2-1456-003chr7:
69411401-69411401
AGintronicDe novo--Yuen2017 G
AUTS2     AU3903301chr7:
69901598-69901598
ATintronicDe novo--Yuen2017 G
AUTS2     1-0546-003chr7:
69238262-69238262
TCintronicDe novo--Yuen2017 G
AUTS2     SP0046081chr7:
69064950-69064950
TCsplicingInheritedsplicing17.77-Feliciano2019 E
AUTS2     AU4463303chr7:
69697901-69697901
GTintronicDe novo--Yuen2017 G
AUTS2     1-0973-003chr7:
69287092-69287092
ACintronicDe novo--Yuen2017 G
AUTS2     7-0055-003chr7:
69212045-69212045
GTintronicDe novo--Yuen2017 G
AUTS2     Lee2020:69chr7:
70255163-70255164
GGGexonicframeshift deletionNM_001127231
NM_015570
c.2890delG
c.2962delG
p.E964fs
p.E988fs
--Lee2020 T
AUTS2     AU3846302chr7:
70015606-70015606
GTintronicDe novo--Yuen2017 G
AUTS2     2-1235-004chr7:
70491966-70491966
TCintergenicDe novo--Yuen2017 G
AUTS2     7-0253-005chr7:
70573190-70573207
CAGAGAGAGAGAGAGAGACAGAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
AUTS2     AU3645301chr7:
70003295-70003295
CTintronicDe novo--Yuen2017 G
AUTS2     5-0103-003chr7:
70069605-70069605
AGintronicDe novo--Yuen2017 G
AUTS2     A15chr7:
69801049-69801049
CTintronicDe novo--Wu2018 G
AUTS2     AU3913302chr7:
69673267-69673267
CTintronicDe novo--Yuen2017 G
AUTS2     2-1297-004chr7:
69618502-69618502
ATintronicDe novo--Yuen2017 G
AUTS2     1-0321-004chr7:
69736910-69736910
GAintronicDe novo--Yuen2017 G
AUTS2     2-1120-003chr7:
69571257-69571257
AGintronicDe novo--Yuen2017 G
AUTS2     AU2022302chr7:
70353573-70353573
CAintergenicDe novo--Yuen2017 G
AUTS2     1-0051-004chr7:
69114258-69114258
CGintronicDe novo--Yuen2017 G
AUTS2     2-1178-003chr7:
69226444-69226444
CGintronicDe novo--Yuen2016 G
Yuen2017 G
AUTS2     2-1267-003chr7:
70211861-70211861
AGintronicDe novo--Yuen2017 G
AUTS2     1-0344-003chr7:
70438887-70438887
AAAGintergenicDe novo--Yuen2017 G
AUTS2     AU3175303chr7:
69919757-69919757
ACintronicDe novo--Yuen2017 G
AUTS2     2-1255-003chr7:
69978991-69978991
AGintronicDe novo--Yuen2016 G
Yuen2017 G
AUTS2     7-0140-003chr7:
69276981-69276981
GTintronicDe novo--Yuen2017 G
AUTS2     AU050704chr7:
70088730-70088730
CGintronicDe novo--Yuen2017 G
AUTS2     AU2756306chr7:
70036981-70036981
AGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More