or
or
Exact

Results for "RASGEF1C"

Variant Events: 14

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RASGEF1C     1-0338-005chr5:
179601401-179601401
CCGTCTGTGTGTGTGTCTGTGTGTGCGCGTGTGTGTintronicDe novo--Yuen2017 G
RASGEF1C     2-0142-003chr5:
179606479-179606479
AAGintronicDe novo--Yuen2017 G
RASGEF1C     3-0432-000chr5:
179590671-179590671
TCintronicDe novo--Yuen2016 G
Yuen2017 G
RASGEF1C     2-1431-003chr5:
179624772-179624772
TAintronicDe novo--Yuen2016 G
Yuen2017 G
RASGEF1C     5-0015-003chr5:
179561842-179561842
AAACTATintronicDe novo--Yuen2017 G
RASGEF1C     2-0319-004chr5:
179630159-179630159
GAintronicDe novo--Yuen2017 G
RASGEF1C     2-1093-003chr5:
179649377-179649389
CCCAGGTCTCGTTCintergenicDe novo--Yuen2017 G
RASGEF1C     1-0403-003chr5:
179601401-179601401
CCGTGTGTGCATGTGTintronicDe novo--Yuen2017 G
RASGEF1C     234-09-111424chr5:
179542325-179542325
CTintronicDe novo--Satterstrom2020 E
RASGEF1C     AU1725302chr5:
179600420-179600420
GAintronicDe novo--Yuen2017 G
RASGEF1C     2-0503-004chr5:
179601401-179601401
CCGCGTGTGTGTintronicDe novo--Yuen2017 G
RASGEF1C     2-1719-003chr5:
179599535-179599535
CTintronicDe novo--Yuen2017 G
RASGEF1C     2-1486-003chr5:
179542022-179542022
CTintronicDe novo--Yuen2016 G
Yuen2017 G
RASGEF1C     A17chr5:
179530147-179530147
GAintronicDe novo--Wu2018 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More