or
or
Exact

Results for "CADM2"

Variant Events: 93

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CADM2     2-1734-003chr3:
86294829-86294829
TCintergenicDe novo--Yuen2017 G
CADM2     SP0001111chr3:
86115818-86115818
CAexonicDe novononsynonymous SNVNM_001167674
NM_001167675
NM_001256503
NM_001256505
NM_153184
NM_001256502
NM_001256504
c.C1193A
c.C1100A
c.C869A
c.C749A
c.C1199A
c.C869A
c.C749A
p.T398K
p.T367K
p.T290K
p.T250K
p.T400K
p.T290K
p.T250K
21.0-Feliciano2019 E
CADM2     AU3905302chr3:
86238127-86238127
CAintergenicDe novo--Yuen2017 G
CADM2     1-0218-003chr3:
85576862-85576862
AGintronicDe novo--Yuen2017 G
CADM2     1-0045-003chr3:
86600746-86600746
CTintergenicDe novo--Yuen2017 G
CADM2     AU018010chr3:
86905862-86905862
CGintergenicDe novo--Yuen2017 G
CADM2     1-0352-005chr3:
86363801-86363801
AGintergenicDe novo--Yuen2017 G
CADM2     AU4246304chr3:
85551526-85551526
GAintronicDe novo--Yuen2017 G
CADM2     14482.p1chr3:
86117978-86117978
CTUTR3De novo--Turner2016 G
CADM2     1-0041-003chr3:
86723624-86723624
TCintergenicDe novo--Yuen2017 G
CADM2     11002.p1chr3:
85338945-85338945
AGintronicDe novo--Turner2016 G
CADM2     AU1668302chr3:
86670113-86670113
GAintergenicDe novo--Yuen2017 G
CADM2     14590.p1chr3:
85628149-85628149
GAintronicDe novo--Turner2016 G
CADM2     AU1542303chr3:
86861636-86861636
GAintergenicDe novo--Yuen2017 G
CADM2     AU3912301chr3:
86249155-86249155
CAintergenicDe novo--Yuen2017 G
CADM2     1-0104-003chr3:
85269171-85269171
GGTGTATTTGTintronicDe novo--Yuen2017 G
CADM2     AU1687302chr3:
86721880-86721880
TAintergenicDe novo--Yuen2017 G
CADM2     1-0079-003chr3:
86496311-86496311
CTintergenicDe novo--Yuen2017 G
CADM2     1-0563-004chr3:
85781294-85781294
CTintronicDe novo--Yuen2017 G
CADM2     7-0002-003chr3:
86128508-86128508
CTintergenicDe novo--Yuen2017 G
CADM2     AU031204chr3:
85165111-85165111
TCintronicDe novo--Yuen2017 G
CADM2     A16chr3:
85927127-85927127
AGintronicDe novo--Wu2018 G
CADM2     5-0017-003chr3:
86460379-86460383
ATTGTAintergenicDe novo--Yuen2017 G
CADM2     2-1089-003chr3:
86705066-86705066
GAintergenicDe novo--Yuen2017 G
CADM2     AU065304chr3:
85356916-85356916
AGintronicDe novo--Yuen2017 G
CADM2     7-0171-003chr3:
85568481-85568481
CTintronicDe novo--Yuen2017 G
CADM2     1-0402-003chr3:
86767825-86767825
TCintergenicDe novo--Yuen2017 G
CADM2     5-0131-003chr3:
85878437-85878437
CTintronicDe novo--Yuen2017 G
CADM2     2-1408-004chr3:
86458826-86458826
AGintergenicDe novo--Yuen2017 G
CADM2     AU038204chr3:
86979541-86979544
GTCTGTCTCTintergenicDe novo--Yuen2017 G
CADM2     AU4067303chr3:
86177371-86177372
TATAAintergenicDe novo--Yuen2017 G
CADM2     1-0080-003chr3:
86576650-86576650
TCintergenicDe novo--Yuen2017 G
CADM2     2-1430-003chr3:
86139681-86139681
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
CADM2     2-0149-005chr3:
85950687-85950687
GAintronicDe novo--Yuen2017 G
CADM2     2-1501-003chr3:
85983934-85983934
AGintronicDe novo--Yuen2017 G
CADM2     2-1562-004chr3:
85082013-85082013
AGintronicDe novo--Yuen2017 G
CADM2     2-0319-004chr3:
86572381-86572381
TCintergenicDe novo--Yuen2017 G
CADM2     3-0080-000chr3:
86203147-86203147
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
CADM2     EGAN00001101164chr3:
86115865-86115865
GAexonicDe novononsynonymous SNVNM_001167674
NM_001167675
NM_001256503
NM_001256505
NM_153184
NM_001256502
NM_001256504
c.G1240A
c.G1147A
c.G916A
c.G796A
c.G1246A
c.G916A
c.G796A
p.D414N
p.D383N
p.D306N
p.D266N
p.D416N
p.D306N
p.D266N
23.8-Satterstrom2020 E
CADM2     5-0061-003chr3:
86286745-86286745
CTintergenicDe novo--Yuen2017 G
CADM2     2-1629-003chr3:
86436992-86436992
CTintergenicDe novo--Yuen2017 G
CADM2     AU058105chr3:
86080555-86080555
TGintronicDe novo--Yuen2017 G
CADM2     1-0279-004chr3:
86954565-86954565
AGintergenicDe novo--Yuen2017 G
CADM2     1-0701-003chr3:
86586965-86586965
AGintergenicDe novo--Yuen2017 G
CADM2     AU4033304chr3:
85992806-85992806
AGintronicDe novo--Yuen2017 G
CADM2     1-0161-004chr3:
86549948-86549948
TCintergenicDe novo--Yuen2017 G
CADM2     1-0294-003chr3:
86357250-86357250
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
CADM2     AU4315302chr3:
86637707-86637707
GTintergenicDe novo--Yuen2017 G
CADM2     2-1093-003chr3:
86267892-86267892
GAintergenicDe novo--Yuen2017 G
CADM2     12445.p1chr3:
85258815-85258815
TTAintronicDe novo--Werling2018 G
CADM2     7-0055-003chr3:
85764258-85764259
ACAintronicDe novo--Yuen2017 G
CADM2     1-0514-003chr3:
85205301-85205301
CGintronicDe novo--Yuen2017 G
CADM2     3-0065-000chr3:
86054427-86054427
CTintronicDe novo--Yuen2017 G
CADM2     AU3787303chr3:
86890883-86890883
GAintergenicDe novo--Yuen2017 G
CADM2     1-0715-003chr3:
86722891-86722891
ATintergenicDe novo--Yuen2017 G
CADM2     2-1245-003chr3:
85980615-85980615
TCintronicDe novo--Yuen2017 G
CADM2     AU3051303chr3:
86872109-86872109
ATintergenicDe novo--Yuen2017 G
CADM2     AU4378301chr3:
85325784-85325784
GAintronicDe novo--Yuen2017 G
CADM2     AU3692301chr3:
85519144-85519144
CTintronicDe novo--Yuen2017 G
CADM2     2-0323-003chr3:
86301444-86301444
GTintergenicDe novo--Yuen2017 G
CADM2     2-1215-003chr3:
86616137-86616137
AGintergenicDe novo--Yuen2017 G
CADM2     2-1325-003chr3:
85423894-85423894
ACintronicDe novo--Yuen2016 G
Yuen2017 G
CADM2     1-0565-003chr3:
85485964-85485964
CTintronicDe novo--Yuen2017 G
CADM2     2-0242-003chr3:
85901340-85901340
TCintronicDe novo--Yuen2017 G
CADM2     2-1215-003chr3:
86160457-86160475
CTGTTCTCCTGGTAGTGAACintergenicDe novo--Yuen2017 G
CADM2     2-1357-003chr3:
86617036-86617036
CTintergenicDe novo--Yuen2017 G
CADM2     1-0652-003chr3:
85413212-85413212
TCintronicDe novo--Yuen2017 G
CADM2     AU073003chr3:
85580258-85580258
CTintronicDe novo--Yuen2017 G
CADM2     AU1687303chr3:
86721880-86721880
TAintergenicDe novo--Yuen2017 G
CADM2     1-0007-003chr3:
85019082-85019082
GAintronicDe novo--Yuen2017 G
CADM2     AU3052302chr3:
85726583-85726583
ATintronicDe novo--Yuen2017 G
CADM2     AU2756306chr3:
86240309-86240309
AGintergenicDe novo--Yuen2017 G
CADM2     1-0253-004chr3:
86138045-86138045
GAintergenicDe novo--Yuen2017 G
CADM2     5-0123-003chr3:
86688072-86688072
GAintergenicDe novo--Yuen2017 G
CADM2     1-0197-003chr3:
85482625-85482625
GAintronicDe novo--Yuen2017 G
CADM2     1-0593-003chr3:
85260323-85260340
TTCTCTCTCTCTCTCTCTTTCTCTCTCTCTCTCTintronicDe novo--Yuen2017 G
CADM2     1-0567-004chr3:
86268210-86268210
GCintergenicDe novo--Yuen2017 G
CADM2     2-1129-003chr3:
85460379-85460379
TCintronicDe novo--Yuen2016 G
Yuen2017 G
CADM2     1-0552-003chr3:
86943179-86943185
GCTGTCTGCTintergenicDe novo--Yuen2017 G
CADM2     1-0352-003chr3:
86363801-86363801
AGintergenicDe novo--Yuen2016 G
CADM2     AU050704chr3:
85052848-85052848
GAintronicDe novo--Yuen2017 G
CADM2     2-1391-004chr3:
86570713-86570716
CAGGCintergenicDe novo--Yuen2017 G
CADM2     A1chr3:
86279343-86279343
GAintergenicDe novo--Wu2018 G
CADM2     AU061003chr3:
85348332-85348332
CAintronicDe novo--Yuen2017 G
CADM2     AU065807chr3:
85372030-85372030
GAintronicDe novo--Yuen2017 G
CADM2     2-0264-004chr3:
86916804-86916804
TCintergenicDe novo--Yuen2017 G
CADM2     2-1230-003chr3:
85562964-85562964
ATintronicDe novo--Yuen2016 G
Yuen2017 G
CADM2     AU4188302chr3:
85894740-85894740
CGintronicDe novo--Yuen2017 G
CADM2     2-1480-003chr3:
86244088-86244088
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
CADM2     AU028305chr3:
86799848-86799848
CAintergenicDe novo--Yuen2017 G
CADM2     AU047904chr3:
86562694-86562694
AGintergenicDe novo--Yuen2017 G
CADM2     AU3857301chr3:
85127774-85127774
AGintronicDe novo--Yuen2017 G
CADM2     2-1264-003chr3:
86180387-86180387
GCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More