or
or
Exact

Results for "CAMTA1"

Variant Events: 53

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CAMTA1     2-1250-003chr1:
6937694-6937695
CTCintronicDe novo--Yuen2017 G
CAMTA1     2-1196-003chr1:
7431737-7431737
GAintronicDe novo--Yuen2016 G
Yuen2017 G
CAMTA1     2-0088-003chr1:
7691859-7691859
AGintronicDe novo--Yuen2017 G
CAMTA1     2-1184-003chr1:
7143510-7143510
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CAMTA1     3-0438-000chr1:
7529260-7529260
CTintronicDe novo--Yuen2016 G
CAMTA1     7-0248-003chr1:
7788523-7788523
GAintronicDe novo--Yuen2017 G
CAMTA1     1-0385-003chr1:
6991691-6991691
GAintronicDe novo--Yuen2017 G
CAMTA1     1-0385-003chr1:
6981883-6981883
GAintronicDe novo--Yuen2017 G
CAMTA1     1-0203-004chr1:
7044239-7044239
GGATGAintronicDe novo--Yuen2017 G
CAMTA1     1-0206-005chr1:
7044243-7044243
AATGTintronicDe novo--Yuen2017 G
CAMTA1     A16chr1:
6908620-6908620
AGintronicDe novo--Wu2018 G
CAMTA1     AU1909304chr1:
7151959-7151959
CTintronicDe novo--Yuen2017 G
CAMTA1     3-0209-000chr1:
6902089-6902089
CTintronicDe novo--Yuen2017 G
CAMTA1     2-0045-003chr1:
7205006-7205006
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CAMTA1     2-1381-003chr1:
7112701-7112701
GAintronicDe novo--Yuen2017 G
CAMTA1     2-1268-003chr1:
7715172-7715172
AGintronicDe novo--Yuen2017 G
CAMTA1     2-1454-003chr1:
6857310-6857310
GAintronicDe novo--Yuen2017 G
CAMTA1     2-1429-003chr1:
6946131-6946131
GGTGCTintronicDe novo--Yuen2017 G
CAMTA1     AU2793303chr1:
7645350-7645350
GAintronicDe novo--Yuen2017 G
CAMTA1     AU017304chr1:
7455151-7455151
CTintronicDe novo--Yuen2017 G
CAMTA1     1-0269-005chr1:
7483358-7483358
GAintronicDe novo--Yuen2017 G
CAMTA1     2-1529-003chr1:
7089656-7089675
ATCTCTCTCTCTCTCTCTCTATCTCTCTCTCTCTCTCTintronicDe novo--Yuen2017 G
CAMTA1     1-0554-003chr1:
6940217-6940217
GAintronicDe novo--Yuen2017 G
CAMTA1     1-0393-003chr1:
6924385-6924385
CTintronicDe novo--Yuen2017 G
CAMTA1     2-1408-003chr1:
7284033-7284033
GAintronicDe novo--Yuen2017 G
CAMTA1     2-1359-004chr1:
7103271-7103271
TCintronicDe novo--Yuen2017 G
CAMTA1     20-0720301-18chr1:
7796454-7796454
CTexonicDe novosynonymous SNVNM_015215c.C3117Tp.V1039V--Satterstrom2020 E
CAMTA1     1-0466-003chr1:
7345568-7345568
CAintronicDe novo--Yuen2017 G
CAMTA1     AU056804chr1:
7036186-7036186
AGintronicDe novo--Yuen2017 G
CAMTA1     AU066104chr1:
7758922-7758922
TAintronicDe novo--Yuen2017 G
CAMTA1     1-0627-005chr1:
7686336-7686336
CTintronicDe novo--Yuen2017 G
CAMTA1     AU011604chr1:
7652044-7652044
CTintronicDe novo--Yuen2017 G
CAMTA1     AU3955303chr1:
6875667-6875667
TGintronicDe novo--Yuen2017 G
CAMTA1     2-1497-003chr1:
6994687-6994687
CTintronicDe novo--Yuen2017 G
CAMTA1     2-1508-003chr1:
7444951-7444951
GAintronicDe novo--Yuen2017 G
CAMTA1     1-1000-003chr1:
7344542-7344542
GAintronicDe novo--Yuen2017 G
CAMTA1     2-1718-003chr1:
7492809-7492809
CTintronicDe novo--Yuen2017 G
CAMTA1     1-0375-003chr1:
7500107-7500107
GAintronicDe novo--Yuen2016 G
Yuen2017 G
CAMTA1     AU4159302chr1:
6995562-6995562
AGintronicDe novo--Yuen2017 G
CAMTA1     1-0019-004chr1:
7730010-7730010
CTintronicDe novo--Yuen2017 G
CAMTA1     AU047904chr1:
7768260-7768260
GAintronicDe novo--Yuen2017 G
CAMTA1     AU4176302chr1:
7712904-7712904
GAintronicDe novo--Yuen2017 G
CAMTA1     1-0184-003chr1:
7209889-7209889
CTintronicDe novo--Yuen2017 G
CAMTA1     2-0219-004chr1:
6936741-6936741
TCintronicDe novo--Yuen2017 G
CAMTA1     2-1164-003chr1:
7826653-7826666
GCACACACACACACGCACACACACACUTR3De novo--Yuen2017 G
CAMTA1     2-1591-003chr1:
7615651-7615651
GAintronicDe novo--Yuen2017 G
CAMTA1     AU027506chr1:
7506858-7506858
GAintronicDe novo--Yuen2017 G
CAMTA1     1442-22354chr1:
7796467-7796467
AGexonicInheritednonsynonymous SNVNM_015215c.A3130Gp.K1044E19.0-Callaghan2019 G
CAMTA1     2-1434-003chr1:
7392954-7392954
GAintronicDe novo--Yuen2016 G
Yuen2017 G
CAMTA1     2-1235-003chr1:
6862058-6862058
AGintronicDe novo--Yuen2017 G
CAMTA1     1-0627-007chr1:
7203432-7203432
GAintronicDe novo--Yuen2017 G
CAMTA1     AU4235302chr1:
7719941-7719941
GAintronicDe novo--Yuen2017 G
CAMTA1     3-0396-000chr1:
7535886-7535886
TCintronicDe novo--Yuen2016 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More