or
or
Exact

Results for "COBL"

Variant Events: 105

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
COBL     1-0520-003chr7:
52418383-52418386
AAGAAAintergenicDe novo--Yuen2017 G
COBL     1-0175-003chr7:
51557163-51557163
CTintergenicDe novo--Yuen2017 G
COBL     1-0402-004chr7:
52736170-52736170
CTintergenicDe novo--Yuen2017 G
COBL     1-0274-003chr7:
52275562-52275562
AACintergenicDe novo--Yuen2017 G
COBL     AU058104chr7:
52368134-52368134
GAintergenicDe novo--Yuen2017 G
COBL     PN400383chr7:
51132922-51132923
TATintronicUnknown-9.0E-4Leblond2019 E
COBL     12778.p1chr7:
52033289-52033289
GAintergenicDe novo--Wilfert2021 G
COBL     1-0522-003chr7:
51754985-51754985
AGintergenicDe novo--Yuen2017 G
COBL     AU3648301chr7:
51855539-51855539
AGintergenicDe novo--Yuen2017 G
COBL     2-1526-003chr7:
52560597-52560597
CTintergenicDe novo--Yuen2017 G
COBL     1-0352-005chr7:
51130152-51130152
CTintronicDe novo--Yuen2017 G
COBL     2-1315-003chr7:
51535029-51535029
GAintergenicDe novo--Yuen2017 G
COBL     AU2019302chr7:
52259956-52259956
TCintergenicDe novo--Yuen2017 G
COBL     2-0270-004chr7:
52265722-52265722
TCintergenicDe novo--Yuen2017 G
COBL     2-1250-003chr7:
52830511-52830511
GCintergenicDe novo--Yuen2017 G
COBL     2-1594-003chr7:
51908410-51908410
TCintergenicDe novo--Yuen2017 G
COBL     2-1250-003chr7:
52833843-52833843
CTintergenicDe novo--Yuen2017 G
COBL     AU070007chr7:
52539465-52539465
GAintergenicDe novo--Yuen2017 G
COBL     UK10K_SKUSE5080183chr7:
51287624-51287624
CGexonicDe novononsynonymous SNVNM_001287436
NM_001287438
NM_015198
c.G59C
c.G59C
c.G59C
p.R20P
p.R20P
p.R20P
21.40.0023DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
COBL     AU3263301chr7:
52531085-52531085
GAintergenicDe novo--Yuen2017 G
COBL     A19chr7:
53032186-53032186
ATintergenicDe novo--Wu2018 G
COBL     1-0433-004chr7:
51196566-51196566
CCCTGCTTGTGCCCTTAintronicDe novo--Yuen2017 G
COBL     AU4013301chr7:
52107010-52107010
AGintergenicDe novo--Yuen2017 G
COBL     5-0095-003chr7:
52084448-52084448
GAintergenicDe novo--Yuen2017 G
COBL     2-1212-003chr7:
52788921-52788921
CTintergenicDe novo--Yuen2017 G
COBL     2-1620-003chr7:
52338807-52338807
CAintergenicDe novo--Yuen2017 G
COBL     AU3918301chr7:
52145273-52145273
AGintergenicDe novo--Yuen2017 G
COBL     1-0142-005chr7:
52561338-52561338
AGintergenicDe novo--Yuen2017 G
COBL     AU3649304chr7:
52632631-52632631
GAintergenicDe novo--Yuen2017 G
COBL     PN400371chr7:
51132922-51132923
TATintronicUnknown-9.0E-4Leblond2019 E
COBL     AU3900302chr7:
51724977-51724977
AGintergenicDe novo--Yuen2017 G
COBL     1-0744-003chr7:
51610981-51610981
CAintergenicDe novo--Yuen2017 G
COBL     5-0116-003chr7:
51902660-51902660
AGintergenicDe novo--Yuen2017 G
COBL     2-1292-003chr7:
51262683-51262683
TCintronicDe novo--Yuen2017 G
COBL     1-0175-004chr7:
51557163-51557163
CTintergenicDe novo--Yuen2017 G
COBL     2-1368-003chr7:
51481392-51481392
TAintergenicDe novo--Yuen2017 G
COBL     AU3912302chr7:
52369860-52369860
GAintergenicDe novo--Yuen2017 G
COBL     1-0303-003chr7:
51735543-51735543
AGintergenicDe novo--Yuen2017 G
COBL     1-0604-003chr7:
52310436-52310436
TCintergenicDe novo--Yuen2017 G
COBL     1-0352-003chr7:
51130152-51130152
CTintronicDe novo--Yuen2016 G
COBL     A16chr7:
51568113-51568113
TGintergenicDe novo--Wu2018 G
COBL     5-0077-004chr7:
52328238-52328242
TCTCCTintergenicDe novo--Yuen2017 G
COBL     2-1258-003chr7:
51733001-51733001
AGintergenicDe novo--Yuen2017 G
COBL     1-0534-003chr7:
52439579-52439579
CTintergenicDe novo--Yuen2017 G
COBL     AU4056301chr7:
51119288-51119288
TCintronicDe novo--Yuen2017 G
COBL     1-0296-004chr7:
52045600-52045600
CTintergenicDe novo--Yuen2017 G
COBL     11572.p1chr7:
51822954-51822954
GAintergenicDe novo--Turner2016 G
COBL     AU4079302chr7:
52301577-52301577
TAintergenicDe novo--Yuen2017 G
COBL     12449.p1chr7:
52468082-52468082
GAintergenicDe novo--Turner2016 G
COBL     A2chr7:
51930694-51930694
CAintergenicDe novo--Wu2018 G
COBL     AU055004chr7:
51958028-51958028
CTintergenicDe novo--Yuen2017 G
COBL     AU036203chr7:
51357265-51357265
GAintronicDe novo--Yuen2017 G
COBL     2-1577-003chr7:
52249826-52249826
CGintergenicDe novo--Yuen2017 G
COBL     7-0161-003chr7:
51957577-51957577
CTintergenicDe novo--Yuen2017 G
COBL     2-1359-003chr7:
52313607-52313607
GAintergenicDe novo--Yuen2017 G
COBL     7-0249-003chr7:
51863891-51863891
CTintergenicDe novo--Yuen2017 G
COBL     2-0202-003chr7:
51911804-51911807
TGAATintergenicDe novo--Yuen2017 G
COBL     AU3849303chr7:
51741197-51741197
ACintergenicDe novo--Yuen2017 G
COBL     2-1368-003chr7:
52308763-52308763
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
COBL     2-1368-003chr7:
52732898-52732898
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
COBL     2-1434-003chr7:
52706974-52706974
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
COBL     2-1561-003chr7:
51101710-51101710
AGintronicDe novo--Yuen2017 G
COBL     1-0079-003chr7:
52507939-52507939
GCintergenicDe novo--Yuen2017 G
COBL     1-0508-003chr7:
51743487-51743487
AGintergenicDe novo--Yuen2017 G
COBL     1-0193-003chr7:
51115207-51115207
ATintronicDe novo--Yuen2017 G
COBL     AU073005chr7:
51868407-51868407
CTintergenicDe novo--Yuen2017 G
COBL     7-0133-003chr7:
51336617-51336617
AGintronicDe novo--Yuen2017 G
COBL     7-0197-003chr7:
52615117-52615117
CTintergenicDe novo--Yuen2017 G
COBL     AU047703chr7:
52475705-52475705
TGintergenicDe novo--Yuen2017 G
COBL     2-1382-003chr7:
51252122-51252122
AGintronicDe novo--Yuen2016 G
Yuen2017 G
COBL     2-0297-003chr7:
51234443-51234443
TCintronicDe novo--Yuen2017 G
COBL     5-0088-003chr7:
52653417-52653417
GCintergenicDe novo--Yuen2017 G
COBL     AU3786301chr7:
51118348-51118348
ACintronicDe novo--Yuen2017 G
COBL     AU3720302 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
COBL     2-0310-003chr7:
52785814-52785814
AGintergenicDe novo--Yuen2017 G
COBL     AU053503chr7:
52974810-52974810
CGintergenicDe novo--Yuen2017 G
COBL     AU4012302chr7:
51182983-51182983
CTintronicDe novo--Yuen2017 G
COBL     1-0563-003chr7:
51529207-51529207
GTintergenicDe novo--Yuen2017 G
COBL     2-1314-003chr7:
52204300-52204300
GAintergenicDe novo--Yuen2016 G
COBL     2-1456-003chr7:
52088523-52088523
CTintergenicDe novo--Yuen2017 G
COBL     7-0251-003chr7:
52044763-52044777
CATATATATATATATCATATATATATATintergenicDe novo--Yuen2017 G
COBL     1-0197-004chr7:
52215346-52215346
CTintergenicDe novo--Yuen2017 G
COBL     AU3858302chr7:
52072720-52072720
GTintergenicDe novo--Yuen2017 G
COBL     1-0153-005chr7:
52665549-52665549
GAintergenicDe novo--Yuen2017 G
COBL     AU4463303chr7:
51336599-51336599
CGintronicDe novo--Yuen2017 G
COBL     1-0225-003chr7:
51708244-51708247
CTTTCTTTTTintergenicDe novo--Yuen2017 G
COBL     1-0433-003chr7:
51196566-51196566
CCCTGCTTGTGCCCTTAintronicDe novo--Yuen2017 G
COBL     1-0329-004chr7:
52122540-52122540
TTGAAAAAAAAAAAAAAAAGAAAAintergenicDe novo--Yuen2017 G
COBL     AU3190305chr7:
53006210-53006210
ATintergenicDe novo--Yuen2017 G
COBL     1-0054-003chr7:
53011113-53011113
AGintergenicDe novo--Yuen2017 G
COBL     2-1210-003chr7:
52642915-52642915
AGintergenicDe novo--Yuen2017 G
COBL     1-0201-005chr7:
53011095-53011095
CGintergenicDe novo--Yuen2017 G
COBL     2-0022-004chr7:
52815603-52815606
CAAACAintergenicDe novo--Yuen2017 G
COBL     14028.p1chr7:
51096116-51096116
CTexonicDe novononsynonymous SNVNM_015198
NM_001287436
c.G2677A
c.G2848A
p.E893K
p.E950K
16.451.649E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
COBL     3-0216-000chr7:
52802573-52802573
AGintergenicDe novo--Yuen2017 G
COBL     1-0232-004chr7:
51987251-51987253
CTACintergenicDe novo--Yuen2017 G
COBL     1-0467-005chr7:
52709858-52709862
CCTTACintergenicDe novo--Yuen2017 G
COBL     2-1308-003chr7:
51275740-51275740
GAintronicDe novo--Yuen2017 G
COBL     AU2950302chr7:
52211479-52211479
TCintergenicDe novo--Yuen2017 G
COBL     2-1120-003chr7:
53011991-53011991
TCintergenicDe novo--Yuen2017 G
COBL     AU031004chr7:
51667668-51667668
CTintergenicDe novo--Yuen2017 G
COBL     2-1267-003chr7:
51528966-51528966
ACintergenicDe novo--Yuen2017 G
COBL     AU4211304chr7:
51492612-51492612
AGintergenicDe novo--Yuen2017 G
COBL     5-0015-003chr7:
51509248-51509248
TCintergenicDe novo--Yuen2017 G
COBL     1-0520-003chr7:
52900474-52900474
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More