or
or
Exact

Results for "MCF2L2"

Variant Events: 13

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MCF2L2     14411.p1chr3:
183027557-183027557
TCexonicDe novononsynonymous SNVNM_015078c.A1060Gp.M354V3.53-Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
MCF2L2     1-0336-004chr3:
183009693-183009693
AGintronicDe novo--Yuen2017 G
MCF2L2     1-0998-003chr3:
182937321-182937321
CTintronicDe novo--Yuen2017 G
MCF2L2     1-0627-004chr3:
183091473-183091473
CTintronicDe novo--Yuen2017 G
MCF2L2     AY081Achr3:
182923938-182923938
CTexonicDe novononsynonymous SNVNM_015078c.G2777Ap.R926Q3.836-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
MCF2L2     1-0508-003chr3:
182996146-182996161
ATGTGTGTGTGTGTGTATGTGTGTGTGTGTintronicDe novo--Yuen2017 G
MCF2L2     G01-GEA-271-HIchr3:
182910862-182910862
CTexonicDe novononsynonymous SNVNM_015078c.G2941Ap.G981R1.7092.0E-4Satterstrom2020 E
MCF2L2     AU0245-0202chr3:
183007024-183007024
AGintronicDe novo--Satterstrom2020 E
MCF2L2     AU4496301chr3:
183158663-183158663
GAintergenicDe novo--Yuen2017 G
MCF2L2     A15chr3:
182950272-182950272
CAintronicDe novo--Wu2018 G
MCF2L2     AU3857301chr3:
182920888-182920888
CGintronicDe novo--Yuen2017 G
MCF2L2     1-0201-004chr3:
183001601-183001601
CTintronicDe novo--Yuen2017 G
MCF2L2     2-0135-003chr3:
182943833-182943833
ATintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More