or
or
Exact

Results for "FHIT"

Variant Events: 105

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FHIT     2-1411-003chr3:
60324540-60324540
CTintronicDe novo--Yuen2017 G
FHIT     AU3763305chr3:
61296964-61296964
TCintergenicDe novo--Yuen2017 G
FHIT     AU3053301chr3:
59978770-59978770
GTintronicDe novo--Yuen2017 G
FHIT     1-0045-003chr3:
59861684-59861684
AAAAAAAAAAAAGintronicDe novo--Yuen2017 G
FHIT     2-1180-003chr3:
60355462-60355462
CTintronicDe novo--Yuen2016 G
Yuen2017 G
FHIT     7-0023-003chr3:
60761863-60761863
CTintronicDe novo--Yuen2017 G
FHIT     AU4473301chr3:
60382326-60382326
AGintronicDe novo--Yuen2017 G
FHIT     1-0495-003chr3:
61485971-61485971
TCintergenicDe novo--Yuen2017 G
FHIT     AU2863303chr3:
60991228-60991228
CTintronicDe novo--Yuen2017 G
FHIT     1-0440-003chr3:
60042153-60042153
CTintronicDe novo--Yuen2017 G
FHIT     AU3636301chr3:
61434344-61434344
GAintergenicDe novo--Yuen2017 G
FHIT     AU3765303chr3:
60018564-60018564
CTintronicDe novo--Yuen2017 G
FHIT     2-0158-003chr3:
59972158-59972158
CTintronicDe novo--Yuen2017 G
FHIT     2-0296-003chr3:
60888508-60888508
GCintronicDe novo--Yuen2017 G
FHIT     2-1581-003chr3:
59779753-59779753
CGintronicDe novo--Yuen2017 G
FHIT     1-0433-004chr3:
61154232-61154232
GAintronicDe novo--Yuen2017 G
FHIT     1-0556-003chr3:
61230830-61230830
GTintronicDe novo--Yuen2017 G
FHIT     AU002903chr3:
60205070-60205070
AGintronicDe novo--Yuen2017 G
FHIT     2-1436-003chr3:
60816072-60816072
CTintronicDe novo--Yuen2017 G
FHIT     2-1501-003chr3:
59986176-59986176
CGintronicDe novo--Yuen2017 G
FHIT     AU3866301chr3:
59888192-59888192
CTintronicDe novo--Yuen2017 G
FHIT     1-0479-006chr3:
61317281-61317293
GAGGTAACACTTAGintergenicDe novo--Yuen2017 G
FHIT     A14chr3:
60559429-60559429
GAintronicDe novo--Wu2018 G
FHIT     1-0191-004chr3:
60336731-60336731
GAintronicDe novo--Yuen2017 G
FHIT     AU076705chr3:
61181753-61181753
AGintronicDe novo--Yuen2017 G
FHIT     AU4231301chr3:
61349605-61349605
TGintergenicDe novo--Yuen2017 G
FHIT     1-0541-004chr3:
59894692-59894692
CAintronicDe novo--Yuen2017 G
FHIT     1-0534-003chr3:
61121910-61121910
CTintronicDe novo--Yuen2017 G
FHIT     AU030804chr3:
60294490-60294490
ATintronicDe novo--Yuen2017 G
FHIT     AU030804chr3:
61473139-61473139
GAintergenicDe novo--Yuen2017 G
FHIT     2-1408-003chr3:
60905515-60905515
GAintronicDe novo--Yuen2017 G
FHIT     2-1178-003chr3:
60553738-60553738
GTintronicDe novo--Yuen2017 G
FHIT     AU021204chr3:
59843700-59843700
ACintronicDe novo--Yuen2017 G
FHIT     AU021204chr3:
59955529-59955529
ATintronicDe novo--Yuen2017 G
FHIT     AU3888302chr3:
60051296-60051296
TGintronicDe novo--Yuen2017 G
FHIT     AU3912302chr3:
59994333-59994333
CGintronicDe novo--Yuen2017 G
FHIT     1-1000-003chr3:
61393733-61393758
AAGAGAGAGAGAGACAGAGAGAGAGAAAGAGAGAGAGACAGAGAGAGAGAintergenicDe novo--Yuen2017 G
FHIT     AU3398301chr3:
60409808-60409808
ACintronicDe novo--Yuen2017 G
FHIT     1-0485-003chr3:
60951778-60951778
CTintronicDe novo--Yuen2017 G
FHIT     2-1129-003chr3:
60990700-60990700
AGintronicDe novo--Yuen2016 G
Yuen2017 G
FHIT     5-0033-004chr3:
60015229-60015229
CGintronicDe novo--Yuen2017 G
FHIT     1-0906-003chr3:
60305468-60305468
TGintronicDe novo--Yuen2017 G
FHIT     2-1353-003chr3:
60213489-60213489
CGintronicDe novo--Yuen2016 G
Yuen2017 G
FHIT     AU054103chr3:
60062810-60062810
AGintronicDe novo--Yuen2017 G
FHIT     2-0238-003chr3:
60470414-60470414
AATACAAAAATTAACTCintronicDe novo--Yuen2017 G
FHIT     2-0264-004chr3:
60216665-60216665
TCintronicDe novo--Yuen2017 G
FHIT     2-1577-003chr3:
60450547-60450547
AGintronicDe novo--Yuen2017 G
FHIT     AU2410302chr3:
59819775-59819775
GAintronicDe novo--Yuen2017 G
FHIT     13843.p1chr3:
60446809-60446809
AAAATACTCTTintronicMaternal--Wilfert2021 G
FHIT     7-0161-003chr3:
60472164-60472164
TCintronicDe novo--Yuen2017 G
FHIT     AU2787301chr3:
60927795-60927795
TCintronicDe novo--Yuen2017 G
FHIT     2-1213-003chr3:
59837468-59837468
CAintronicDe novo--Yuen2017 G
FHIT     5-0140-003chr3:
60451623-60451623
ACintronicDe novo--Yuen2017 G
FHIT     1-0683-004chr3:
60221939-60221939
ACintronicDe novo--Yuen2017 G
FHIT     1-0271-004chr3:
61120609-61120609
CTintronicDe novo--Yuen2017 G
FHIT     AU4412302chr3:
60981169-60981169
CGintronicDe novo--Yuen2017 G
FHIT     AU4072303chr3:
61349359-61349359
CTintergenicDe novo--Yuen2017 G
FHIT     7-0191-003chr3:
59887088-59887088
AGintronicDe novo--Yuen2017 G
FHIT     AU4327303chr3:
60568913-60568913
TGintronicDe novo--Yuen2017 G
FHIT     2-1327-004chr3:
61369029-61369029
CGintergenicDe novo--Yuen2017 G
FHIT     2-1525-003chr3:
61487944-61487944
TCintergenicDe novo--Yuen2017 G
FHIT     5-0117-003chr3:
59949065-59949065
ACintronicDe novo--Yuen2017 G
FHIT     1-0995-003chr3:
60417102-60417102
GTintronicDe novo--Yuen2017 G
FHIT     5-0117-003chr3:
59962937-59962937
AGintronicDe novo--Yuen2017 G
FHIT     1-0285-004chr3:
60030834-60030834
CTintronicDe novo--Yuen2017 G
FHIT     1-0043-004chr3:
61363499-61363499
CTintergenicDe novo--Yuen2017 G
FHIT     AU3646301chr3:
59789548-59789548
GAintronicDe novo--Yuen2017 G
FHIT     AU073005chr3:
60351483-60351483
ACintronicDe novo--Yuen2017 G
FHIT     A24chr3:
59992714-59992714
ATintronicDe novo--Wu2018 G
FHIT     A24chr3:
59992719-59992719
TCintronicDe novo--Wu2018 G
FHIT     AU058103chr3:
60973659-60973659
CTintronicDe novo--Yuen2017 G
FHIT     2-0318-004chr3:
60570003-60570003
TGintronicDe novo--Yuen2017 G
FHIT     2-1696-003chr3:
61423505-61423505
TGintergenicDe novo--Yuen2017 G
FHIT     1-0046-003chr3:
60687161-60687161
CGintronicDe novo--Yuen2017 G
FHIT     1-0546-003chr3:
60590832-60590845
AACACACACACACAAACACACACACAintronicDe novo--Yuen2017 G
FHIT     2-1246-003chr3:
60019634-60019634
CAintronicDe novo--Yuen2017 G
FHIT     AU2000305chr3:
60873731-60873731
TCintronicDe novo--Yuen2017 G
FHIT     1-0303-004chr3:
60214955-60214955
GAintronicDe novo--Yuen2017 G
FHIT     2-1406-003chr3:
60324637-60324637
CTintronicDe novo--Yuen2016 G
Yuen2017 G
FHIT     2-1210-003chr3:
60750538-60750538
TCintronicDe novo--Yuen2017 G
FHIT     2-0238-004chr3:
60470414-60470414
AATACAAAAATTAACTCintronicDe novo--Yuen2017 G
FHIT     AU3680301chr3:
60063460-60063460
AGintronicDe novo--Yuen2017 G
FHIT     AU054303chr3:
59819743-59819743
ACintronicDe novo--Yuen2017 G
FHIT     2-0244-004chr3:
61378525-61378525
CTintergenicDe novo--Yuen2017 G
FHIT     2-1592-003chr3:
60589917-60589917
GAintronicDe novo--Yuen2017 G
FHIT     AU3900301chr3:
61345070-61345070
CAintergenicDe novo--Yuen2017 G
FHIT     2-1290-004chr3:
61475165-61475165
CTintergenicDe novo--Yuen2017 G
FHIT     2-1497-003chr3:
60911122-60911122
TCintronicDe novo--Yuen2017 G
FHIT     AU3154302chr3:
61005302-61005302
TCintronicDe novo--Yuen2017 G
FHIT     1-0450-003chr3:
61055856-61055856
GCintronicDe novo--Yuen2017 G
FHIT     AU3760301chr3:
60759460-60759460
TCintronicDe novo--Yuen2017 G
FHIT     2-1195-003chr3:
60174733-60174733
CAintronicDe novo--Yuen2016 G
Yuen2017 G
FHIT     AU4234302chr3:
60259203-60259203
GCintronicDe novo--Yuen2017 G
FHIT     1-0019-004chr3:
60191710-60191710
AAATAAAAATintronicDe novo--Yuen2017 G
FHIT     11252.p1chr3:
60183760-60183760
CTintronicDe novo--Turner2016 G
FHIT     13023.p1chr3:
60224371-60224371
GAintronicDe novo--Turner2016 G
FHIT     AU4433301chr3:
60720177-60720177
GAintronicDe novo--Yuen2017 G
FHIT     2-1702-003chr3:
60824266-60824266
TCintronicDe novo--Yuen2017 G
FHIT     7-0143-003chr3:
60342858-60342858
AGintronicDe novo--Yuen2017 G
FHIT     1-0871-003chr3:
60344775-60344775
AGintronicDe novo--Yuen2017 G
FHIT     2-1127-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
FHIT     1-0377-003chr3:
60089066-60089066
CTintronicDe novo--Yuen2017 G
FHIT     5-0055-003chr3:
59894760-59894760
AAAGAACATintronicDe novo--Yuen2017 G
FHIT     2-0081-003chr3:
60656489-60656489
GTintronicDe novo--Yuen2017 G
FHIT     7-0100-004chr3:
59861586-59861586
GCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More