or
or
Exact

Results for "NKAIN2"

Variant Events: 53

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NKAIN2     AU003403chr6:
124777289-124777289
TCintronicDe novo--Yuen2017 G
NKAIN2     1-0651-003chr6:
124379162-124379164
AGGAGintronicDe novo--Yuen2017 G
NKAIN2     2-0264-004chr6:
124845033-124845033
TAintronicDe novo--Yuen2017 G
NKAIN2     3-0246-000chr6:
125088568-125088568
CGintronicDe novo--Yuen2017 G
NKAIN2     AU005214chr6:
124353831-124353831
CTintronicDe novo--Yuen2017 G
NKAIN2     AU4072303chr6:
124290052-124290052
TAintronicDe novo--Yuen2017 G
NKAIN2     AU1955302chr6:
125212677-125212677
CTintergenicDe novo--Yuen2017 G
NKAIN2     AU3905301chr6:
124937146-124937147
TGTintronicDe novo--Yuen2017 G
NKAIN2     AU4199303chr6:
124819377-124819377
AGintronicDe novo--Yuen2017 G
NKAIN2     AU4483301chr6:
124590694-124590696
ACCACintronicDe novo--Yuen2017 G
NKAIN2     2-1456-004chr6:
124798044-124798047
TACATintronicDe novo--Yuen2017 G
NKAIN2     AU4186302chr6:
124164787-124164787
AGintronicDe novo--Yuen2017 G
NKAIN2     1-0261-004chr6:
124370915-124370915
CAintronicDe novo--Yuen2017 G
NKAIN2     AU051503chr6:
124340270-124340271
ACAintronicDe novo--Yuen2017 G
NKAIN2     AU4487302chr6:
124819747-124819747
GCintronicDe novo--Yuen2017 G
NKAIN2     1-0261-004chr6:
124365612-124365612
GAintronicDe novo--Yuen2017 G
NKAIN2     7-0191-003chr6:
124333214-124333234
ATAAAATGCATATAATTAAAGAintronicDe novo--Yuen2017 G
NKAIN2     1-0325-003chr6:
124921570-124921570
TAintronicDe novo--Yuen2017 G
NKAIN2     1-0497-003chr6:
125020570-125020570
AGintronicDe novo--Yuen2017 G
NKAIN2     AU2863302chr6:
124480865-124480865
AGintronicDe novo--Yuen2017 G
NKAIN2     1-0490-003chr6:
125132507-125132507
AGintronicDe novo--Yuen2017 G
NKAIN2     2-1731-003chr6:
124859656-124859656
TCintronicDe novo--Yuen2017 G
NKAIN2     A28chr6:
125016406-125016406
TCintronicDe novo--Wu2018 G
NKAIN2     AU4263304chr6:
124770812-124770812
AGintronicDe novo--Yuen2017 G
NKAIN2     2-1381-003chr6:
124720621-124720621
CTintronicDe novo--Yuen2017 G
NKAIN2     2-0272-004chr6:
124727434-124727434
CCTATAAACTAGintronicDe novo--Yuen2017 G
NKAIN2     2-1066-003chr6:
124626031-124626031
GCintronicDe novo--Yuen2017 G
NKAIN2     A31chr6:
125183897-125183898
GAGintergenicDe novo--Wu2018 G
NKAIN2     2-0319-004chr6:
124375821-124375821
CAintronicDe novo--Yuen2017 G
NKAIN2     2-1283-004chr6:
124801697-124801697
CAintronicDe novo--Yuen2017 G
NKAIN2     AU2975301chr6:
124245200-124245200
TCintronicDe novo--Yuen2017 G
NKAIN2     AU3635301chr6:
124720918-124720918
GAintronicDe novo--Yuen2017 G
NKAIN2     2-1456-003chr6:
124798044-124798047
TACATintronicDe novo--Yuen2017 G
NKAIN2     AU4356302chr6:
124347353-124347353
TAintronicDe novo--Yuen2017 G
NKAIN2     AU4067301chr6:
124371237-124371237
AGintronicDe novo--Yuen2017 G
NKAIN2     1-0299-003chr6:
124746954-124746954
GCintronicDe novo--Yuen2017 G
NKAIN2     2-1093-003chr6:
124170177-124170177
AGintronicDe novo--Yuen2017 G
NKAIN2     1-0393-003chr6:
124955632-124955632
CGintronicDe novo--Yuen2017 G
NKAIN2     AU1725306chr6:
124571773-124571776
GAAAGAintronicDe novo--Yuen2017 G
NKAIN2     AU2951303chr6:
124784108-124784108
CTintronicDe novo--Yuen2017 G
NKAIN2     1-0699-003chr6:
124976997-124976997
CTintronicDe novo--Yuen2017 G
NKAIN2     2-0278-003chr6:
124469738-124469738
GAintronicDe novo--Yuen2017 G
NKAIN2     1-0404-003chr6:
125029479-125029479
TCintronicDe novo--Yuen2017 G
NKAIN2     A15chr6:
124684047-124684047
CTintronicDe novo--Wu2018 G
NKAIN2     1-0486-003chr6:
124891180-124891180
GAintronicDe novo--Yuen2017 G
NKAIN2     1-0025-004chr6:
124588750-124588750
CTintronicDe novo--Yuen2017 G
NKAIN2     AU2951302chr6:
124784108-124784108
CTintronicDe novo--Yuen2017 G
NKAIN2     AU0636303chr6:
124886504-124886504
ACintronicDe novo--Yuen2017 G
NKAIN2     2-1646-003chr6:
124441932-124441932
TAintronicDe novo--Yuen2017 G
NKAIN2     AU3721302chr6:
124248071-124248071
TAintronicDe novo--Yuen2017 G
NKAIN2     12574.p1chr6:
125121807-125121807
TCintronicDe novo--Wilfert2021 G
NKAIN2     7-0255-003chr6:
124249166-124249166
CTintronicDe novo--Yuen2017 G
NKAIN2     2-1461-003chr6:
125179316-125179316
ACintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More