or
or
Exact

Results for "CEP128"

Variant Events: 28

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CEP128     1-0498-003chr14:
81314439-81314439
TCintronicDe novo--Yuen2017 G
CEP128     1-0455-003chr14:
81404039-81404039
TTACAintronicDe novo--Yuen2017 G
CEP128     1-0345-004chr14:
81308779-81308779
TCintronicDe novo--Yuen2017 G
CEP128     2-1254-003chr14:
81308284-81308284
TAintronicDe novo--Yuen2016 G
CEP128     AU2951303chr14:
81069359-81069359
AGintronicDe novo--Yuen2017 G
CEP128     7-0248-003chr14:
81337635-81337635
GTintronicDe novo--Yuen2017 G
CEP128     1-0834-003chr14:
80986078-80986078
AGintronicDe novo--Yuen2017 G
CEP128     AU049304chr14:
81109668-81109669
CACintronicDe novo--Yuen2017 G
CEP128     AU2072302chr14:
81120630-81120630
AGintronicDe novo--Yuen2017 G
CEP128     2-1266-003chr14:
81413266-81413266
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
CEP128     AU2951302chr14:
81069359-81069359
AGintronicDe novo--Yuen2017 G
CEP128     2-0127-004chr14:
81278240-81278240
GTintronicDe novo--Yuen2017 G
CEP128     11294.p1chr14:
81302669-81302669
GAexonicDe novononsynonymous SNVNM_152446c.C937Tp.R313C17.26-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
CEP128     1-0191-003chr14:
81091999-81091999
CTintronicDe novo--Yuen2017 G
CEP128     AU2975302chr14:
81083529-81083529
TCintronicDe novo--Yuen2017 G
CEP128     A16chr14:
80969320-80969320
AGintronicDe novo--Wu2018 G
CEP128     1-0112-004chr14:
80972405-80972407
GGAGintronicDe novo--Yuen2017 G
CEP128     EGAN00001101026chr14:
81362124-81362124
CAexonicDe novostopgainNM_152446c.G583Tp.E195X38.02.658E-5Satterstrom2020 E
CEP128     13637.p1chr14:
81015640-81015640
CTintronicDe novo--Wilfert2021 G
CEP128     AU4033303chr14:
81063964-81063979
CAAAGAAAGAAAGAAACAAAGAAAGAAAintronicDe novo--Yuen2017 G
CEP128     AU3649305chr14:
81171212-81171212
TCintronicDe novo--Yuen2017 G
CEP128     A24chr14:
81186003-81186003
GAintronicDe novo--Wu2018 G
CEP128     AU3124302chr14:
81014564-81014564
CAintronicDe novo--Yuen2017 G
CEP128     AU3154301chr14:
81114324-81114324
TAintronicDe novo--Yuen2017 G
CEP128     AU4336301chr14:
81090125-81090125
TCintronicDe novo--Yuen2017 G
CEP128     2-1508-004chr14:
81057398-81057398
TCintronicDe novo--Yuen2017 G
CEP128     1-0006-004chr14:
81028738-81028738
AATintronicDe novo--Yuen2017 G
CEP128     SP0036859chr14:
81302622-81302622
AGexonicDe novosynonymous SNVNM_152446c.T984Cp.H328H4.038-Feliciano2019 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More